Laboratory Information

NameVC View on WormBase
Allele designationgk
HeadDonald Gordon Moerman
InstitutionUniversity of British Columbia, Vancouver BC, Canada
Address University of British Columbia
2350 Health Sciences Mall
Vancouver V6T 1Z3
Canada
Website http://www.zoology.ubc.ca/~dgmweb/
Gene classes tag 

Strains contributed by this laboratory

Strain Genotype Species Description
DM1017 unc-52(e3003e998) II; ccar-1(ra5) IV. C. elegans Suppressed Unc-52. This strain was isolated after EMS mutagenesis of CB998 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to the unc-52 and sup-38 mutations, it is homozygous for 300 other mutations determined from sequence data. All mutations are annotated in WormBase. The e3003 and e998 mutations were present in the original CB998 strain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
DM1245 unc-112(r367) V; Y102F5A.1(ra238) dim-1(ra204) X. C. elegans Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
DM5116 unc-112(gk1)/unc-39(e257) V. C. elegans C47E8.7. Heterozygotes are WT and segregate WT, Pat unc-112 homozygotes and Unc homozygotes. Pick WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DM5117 unc-52(gk3) II. C. elegans ZC101.2a. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DR2386 daf-25(m362) I. C. elegans Maintain at 15C. Daf-C. Reference: Jensen VL, et al. PLoS Genet. 2010 Nov 24;6(11):e1001199.
GE1713 unc-32(e189) ZK688.9(t1433)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1433 homozygotes that produce arrested embryos (approximately 100 cells). GE1713 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE1735 unc-32(e189) top-3(t1470)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1470 homozygotes that produce arrested embryos. GE1735 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE1742 unc-32(e189) bckd-1A(t1461)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1461 homozygotes that produce dead eggs. GE1742 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE1936 xpf-1(e1487) II; unc-24(e138) atg-7(t1738)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. C. elegans Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1738 homozygotes that produce dead embryos. GE1936 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE1939 xpf-1(e1487) II; unc-24(e138) trcs-1(t1745)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. C. elegans Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1745 homozygotes that produce dead eggs at restrictive temperature. GE1939 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE1958 xpf-1(e1487) II; unc-24(e138) atg-7(t1726)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. C. elegans Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1726 homozygotes that produce dead embryos. GE1958 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2047 xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) cept-2(t2021)/nt1[let (m435)] V. C. elegans Temperature-sensitive maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2021 homozygotes that produce dead eggs at restrictive temperature. GE2047 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2122 xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) cept-2(t2007)/nt1[let (m435)] V. C. elegans Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2007 homozygotes that produce dead eggs. GE2122 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2153 xpf-1(e1487) II; unc-24(e138) wapl-1(t1773)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. C. elegans Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1773 homozygotes that do not produce viable progeny. GE2153 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2200 unc-32(e189) bckd-1A(t1480)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1480 homozygotes that produce dead eggs. GE2200 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2237 unc-32(e189) pod-1(t1614)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1614 homozygotes that do not produce viable progeny. GE2237 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2277 unc-32(e189) such-1(t1496)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1496 homozygotes that do not produce viable progeny. GE2277 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2305 xpf-1(e1487) II; unc-24(e138) wapl-1(t1867)/nt1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. C. elegans Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1867 homozygotes that do not produce viable progeny. GE2305 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2335 xpf-1(e1487) II; unc-24(e138)/nT1[let (m435)] IV; dpy-11(e224) dlat-1(t2056)/nT1[let (m435)] V. C. elegans Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2056 homozygotes that produce dead eggs. GE2335 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2391 xpf-1(e1487) II; unc-24(e138) perm-5(t1932)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. C. elegans Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1932 homozygotes that produce dead embryos. GE2391 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2399 unc-32(e189) top-3(t1559)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1559 homozygotes that produce arrested embryos. GE2399 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2453 xpf-1(e1487) II; unc-24(e138) perm-5(t1900)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. C. elegans Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1900 homozygotes that produce dead embryos. GE2453 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2512 xpf-1(e1487) II; unc-24(e138) trcs-1(t1909)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. C. elegans Leaky temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1909 homozygotes that produce dead eggs at restrictive temperature. GE2512 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2541 xpf-1(e1487) II; unc-24(e138)/nT1[let (m435)] IV; dpy-11(e224) dlat-1(t2035)/nT1[let (m435)] V. C. elegans Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2035 homozygotes that produce dead eggs. GE2541 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2605 unc-32(e189) pod-1(t1674)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1674 homozygotes that do not produce viable progeny. GE2605 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2621 unc-32(e189) ZK688.9(t1587)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1587 homozygotes that produce arrested embryos. GE2621 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2666 unc-32(e189) such-1(t1693)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1693 homozygotes that do not produce viable progeny. GE2666 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2734 xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2029)/nt1[let (m435)] V. C. elegans Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2827 xpf-1(e1487) II; unc-24(e138) T22B11.1(t1786)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. C. elegans Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1786 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2827 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2886 xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2055)/nt1[let (m435)] V. C. elegans Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2055 homozygotes that produce unfertilized oocytes. GE2886 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2895 xpf-1(e1487) II; unc-24(e138) T22B11.1(t1866)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. C. elegans Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1866 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2895 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
RB1376 rab-33&taf-11.3(ok1561) III. C. elegans F43D9.5, F43D9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1384 dod-21&C32H11.11(ok1569) IV. C. elegans C32H11.10, C32H11.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1385 F36A2.7&rps-15(ok1570) I. C. elegans F36A2.7, F36A2.6. Superficially wild type. [NOTE: (07/17/13) The CGC has received a report that this strain is heterozygous for ok1570. We are working to obtain a replacement stock.] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1386 M04D8.7(ok1571) III. C. elegans M04D8.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1387 M04D8.6(ok1572) III. C. elegans M04D8.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1388 ZK1251.1&ins-7(ok1573) IV. C. elegans ZK1251.1, ZK1251.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1395 spp-10(ok1585) IV. C. elegans C28C12.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1398 vhl-1&F08G12.5(ok241) X. C. elegans F08G12.4, F08G12.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1399 T01H8.2(ok340) I. C. elegans T01H8.2. Superficially wild type. NOTE: It has been reported that this strain has a low brood size and is prone to going sterile. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1401 T19B10.6(ok260) V. C. elegans T19B10.6. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1407 nhr-60(ok1600) V. C. elegans F57A10.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1408 C32B5.16(ok1601) II. C. elegans C32B5.16. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1411 spas-1(ok1608) V. C. elegans C24B5.2. Homozygous. Outer Left Sequence: TCCGTTGCGACTTCTTTTCT. Outer Right Sequence: GCCACGTGATGATCAATCTG. Inner Left Sequence: CAGTTCCAATGTTCGCCTTT. Inner Right Sequence: CAAATTGAAATGGAATCGCA. Inner Primer PCR Length: 2282 bp. Deletion Size: 627 bp. Deletion left flank: GTTTGTTTGATTATTGCCGGCAATATTGAT. Deletion right flank: AAAACGGGTCAAAGTCGACAAGGTGTTTAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1418 dod-18&C54G4.7(ok1615) I. C. elegans C54G4.6, C54G4.7. Homozygous. Outer Left Sequence: TCACAATGCTATCGGGTCAA. Outer Right Sequence: GGAAAGAGAGTGGCATGAGG. Inner Left Sequence: ACAATCCGAGAAACTCGTGG. Inner Right Sequence: CTTGCGAAAAATCCCTCGTA. Inner Primer PCR Length: 2192 bp. Deletion Size: 820 bp. Deletion left flank: CATTGGCATCTGTTGGTTTTCCAATAATTT. Deletion right flank: AATAATTCTCAGAAATATTCAAAAAATGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1420 rbx-2(ok1617) I. C. elegans R10A10.2. Homozygous. Outer Left Sequence: CATCTCCACGAGCACTGAAA. Outer Right Sequence: AACAGACGGAAAACGACCAG. Inner Left Sequence: CGGTGGAAAAACTCTGGAAA. Inner Right Sequence: CGTCTCCTCCGAAATTGAAA. Inner Primer PCR Length: 2101 bp. Deletion Size: 759 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1425 nhr-60(ok1622) V. C. elegans F57A10.5. Homozygous. Outer Left Sequence: ATGTGACGTTCGACTGCAAC. Outer Right Sequence: CCCAACTGAATGCCTGATTT. Inner Left Sequence: CGCCGTTCTAACTGGAATGT. Inner Right Sequence: AAGGAATAGAGCTGTGCCGA. Inner Primer PCR Length: 2872 bp. Deletion Size: 989 bp. Deletion left flank: GGATCAACGGTGCAACAGACATCACAGAAG. Deletion right flank: TATTGTTTTGCTAGTAGCTAATTTAACTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1428 lec-3&nlt-1(ok274) II. C. elegans ZK892.1, ZK892.2. Superficially wild type. Outer Left Sequence: GCACCGTATCCCACTCAACT. Outer Right Sequence: GTACCACCAGCTCCGTTCAT. Inner Left Sequence: ATGGGGATGTTGTCCTGAAC. Inner Right Sequence: AAACTTTTGATGGCGGTCAC. Inner Primer WT PCR Product: 3275. Deletion size: 1855 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1430 klp-17&rga-1(ok1630) II. C. elegans W02B12.8, W02B12.7. Homozygous. Outer Left Sequence: CCGGTTTCCAGATTCAAAAA. Outer Right Sequence: AAGAGCGAGAAGTGGCCATA. Inner Left Sequence: AGTGCATCCAACACGATTCA. Inner Right Sequence: AATGCAAAAGCTGAACACCC. Inner Primer PCR Length: 2898 bp. Deletion Size: 1008 bp. Deletion left flank: AACTCCGGATTGGGCGGTCGGAGGAAAGAA. Deletion right flank: AGAATTAATAAAGGTATTTAATAGGCTAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1437 F49E12.1(ok1640) II. C. elegans F49E12.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1441 ari-1.4(ok1644) IV. C. elegans Y73F8A.34. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1446 Y39A3CL(ok1650) III. C. elegans Y39A3CL. Homozygous. Outer Left Sequence: CTACGGTACGCAAGTACGCA. Outer Right Sequence: AAAGTCTGCCAAAAGCGAAA. Inner Left Sequence: GAAAATGCGGACAAGTGGAT. Inner Right Sequence: TTTGACGCCTTCTCTCGTTT. Inner Primer PCR Length: 2301 bp. Deletion Size: 1281 bp. Deletion left flank: TTGAAAGTACAGTACCCCTAAATTTCGAAA. Deletion right flank: ATCTTCGACTATTAGCCTTTTATTTCAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1448 T26C11.2&T26C11.3(ok1652) X. C. elegans T26C11.2, T26C11.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1451 rsp-5(ok324) II. C. elegans T28D9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1464 T12D8.3(ok1692) III. C. elegans T12D8.3. Homozygous. Outer Left Sequence: TCTCGTGCGGTTTCATATTG. Outer Right Sequence: CAAAGCCGAGGAAACTTCAG. Inner Left Sequence: AGAAACGGGGAGAAATGGAT. Inner Right Sequence: TTTGTCCCCTCGTCACTTTC. Inner Primer PCR Length: 2584 bp. Deletion Size: 788 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1465 C23H3.4(ok1693) II. C. elegans C23H3.4. Homozygous. Outer Left Sequence: CCAAATTCCCCACTTACCCT. Outer Right Sequence: CTGAAATTTTGCCACGGATT. Inner Left Sequence: AGCCCAAGCCAATTATCCTT. Inner Right Sequence: AACACGAACTTTGAATCGCC. Inner Primer PCR Length: 3320 bp. Deletion Size: 963 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1469 T28D9.4&T28D9.7(ok1705) II. C. elegans T28D9.7, T28D9.4. Homozygous. Outer Left Sequence: TTCGTGATGGTCCATTGAAA. Outer Right Sequence: GGATGTGCTCAAAAAGCGAT. Inner Left Sequence: GGAATCGCGTCTTTTCAGAG. Inner Right Sequence: TGATTACACTGCTTGGCAGG. Inner Primer PCR Length: 3125 bp. Deletion Size: 1060 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1486 F13G3.5(ok1743) I. C. elegans F13G3.5. Homozygous. Outer Left Sequence: GGGGGAAATGATGGAAGATT. Outer Right Sequence: TACATCGCAAAATGGGACAA. Inner Left Sequence: GAGAATTGGCGGTAAACGAG. Inner Right Sequence: TTCACAATCTGGAGTGCTGG. Inner Primer PCR Length: 3451 bp. Deletion Size: 1259 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1495 ZK355.3(ok1760) II. C. elegans ZK355.3. Homozygous. Outer Left Sequence: GTCTGGGCGATCCTGTATGT. Outer Right Sequence: GTAGGCGTAGGCGAGATGAG. Inner Left Sequence: AAGACCAAGCTGAGATCGGA. Inner Right Sequence: CTTTTCTCCTGGACTGCACC. Inner Primer PCR Length: 2231 bp. Deletion Size: 1814 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1507 Y39F10A.3(ok1777) II. C. elegans Y39F10A.3. Homozygous. Outer Left Sequence: CAACGTCGTGGTATTCGTTG. Outer Right Sequence: AATCGCGAGACAAGAAGCAT. Inner Left Sequence: GATCTGAGGACGCAAATGGT. Inner Right Sequence: TGAGCCATTGACAGAAGCAG. Inner Primer PCR Length: 2145 bp. Deletion Size: 930 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1515 far-6(ok1811) IV. C. elegans W02A2.2. Homozygous. Outer Left Sequence: AGTTTGCCGAAAGAAAGCAA. Outer Right Sequence: AATGCCGGACAACAGGTAAG. Inner Left Sequence: AGCCAAGACTCGCCTAATCA. Inner Right Sequence: AGATCGGCAACCAATTCAAC. Inner Primer PCR Length: 2542 bp. Deletion Size: 1093 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1529 Y43F8C.5(ok1834) V. C. elegans Y43F8C.5. Homozygous. Outer Left Sequence: ATGCTCGGAAATCGAAAGAA. Outer Right Sequence: ACATGGTTTTCTGTAGGGCG. Inner Left Sequence: GGCAGAAGGTTGCTCATGTT. Inner Right Sequence: GAATTCCGGCTCTTTTGTCA. Inner Primer PCR Length: 2345 bp. Deletion Size: 1795 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1530 sru-11(ok1835) IV. C. elegans Y45F10B.6. Homozygous. Outer Left Sequence: GCAAATTGGAGATACCCGAA. Outer Right Sequence: CAACGTGTTTTGATGAACGG. Inner Left Sequence: CCCAAATCCCGAGAAGTACA. Inner Right Sequence: AATTCGGCATTGGAAAACAG. Inner Primer PCR Length: 2781 bp. Deletion Size: 746 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1532 K05F6.11(ok1837) II. C. elegans K05F6.11. Homozygous. Outer Left Sequence: TGGCTAGCCCTACCTTTCCT. Outer Right Sequence: CCAAGGGTGTCATCGAAAGT. Inner Left Sequence: TTCAAAGCCCCTCGTTTCTA. Inner Right Sequence: TCTTGCAAAGGCAAGATTCA. Inner Primer PCR Length: 3109 bp. Deletion Size: 1437 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1534 npp-16(ok1839) III. C. elegans Y56A3A.17. Homozygous. Outer Left Sequence: CACTGAAACAGTGCGGAGAG. Outer Right Sequence: AGACGCTGAAAGAGGTTCCA. Inner Left Sequence: TGACTCATCGAGCCTGAAAA. Inner Right Sequence: GAGTCGAACTTCCCAAGCAG. Inner Primer PCR Length: 2218 bp. Deletion Size: 1120 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1535 arf-1.1&F45E4.7(ok1840) IV. C. elegans F45E4.1, F45E4.7. Homozygous. Outer Left Sequence: CAAGGCAATCGTGAGTGAGA. Outer Right Sequence: TTGCATTCATTGAACCTCCA. Inner Left Sequence: AAGGAAAATGTTCGTGGTCG. Inner Right Sequence: GGATGCAAACCGACAGAGAT. Inner Primer PCR Length: 2145 bp. Deletion Size: 1065 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1537 rab-19(ok1845) IV. C. elegans Y62E10A.9. Homozygous. Outer Left Sequence: GACGACGATCGGTAGGAAAA. Outer Right Sequence: AGGAATGGATTTTTGTTGCG. Inner Left Sequence: GGCCGGGTCGAGTAATAAAT. Inner Right Sequence: TTCAACACTCTTGCCGTCTG. Inner Primer PCR Length: 2213 bp. Deletion Size: 1257 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1544 F11A5.4(ok1857) V. C. elegans F11A5.4. Homozygous. Outer Left Sequence: TGCTATGGAAGCGACTGTTG. Outer Right Sequence: TGCTTGCTTCATTTTTCACG. Inner Left Sequence: TTATCCCTTTTCCCCATTCC. Inner Right Sequence: ATACCTGCCATTGGACTTCG. Inner Primer PCR Length: 2332 bp. Deletion Size: 658 bp. Deletion left flank: CACGAGATTTATAGAAAGCTTAACTTTGGA. Deletion right flank: TATGCGCATGGTGGTCTTTGCCGAGTTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1559 acr-2(ok1887) X. C. elegans K11G12.2. Homozygous. Outer Left Sequence: GGGTCCGTCCTTTAGACCAT. Outer Right Sequence: TGTTGTTGCTGGAGCAATTC. Inner Left Sequence: CCCTGCATATGTGTGAAACG. Inner Right Sequence: CGCTTTTCCAGTTTTTGACC. Inner Primer PCR Length: 3281 bp. Deletion Size: 2857 bp. Deletion left flank: AAAGAAGTGAAGCGGCTCTACCACCCCGAC. Deletion right flank: AGAAATCATGTTTGGAAAACAAAAATATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1561 F46A8.5(ok1895) I. C. elegans F46A8.5. Homozygous. Outer Left Sequence: GATCGACTTTTGCGAAGGAG. Outer Right Sequence: GCTGGTGCCCAGTTTAATGT. Inner Left Sequence: CACGCCAAAACCTCTGATTT. Inner Right Sequence: ATGGTCAATCAGCCAACACA. Inner Primer PCR Length: 2593 bp. Deletion Size: 880 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1563 T01C3(ok1897) V. C. elegans T01C3. Homozygous. Outer Left Sequence: CCTGGCTGTTACCCAAGTGT. Outer Right Sequence: GCTCACATGAAGTGCAGCAT. Inner Left Sequence: CGAGAAGGGAAATTCCACAA. Inner Right Sequence: TGTGTAGGCTCCCTAATGCC. Inner Primer PCR Length: 2419 bp. Deletion Size: 762 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1564 F19H8.2(ok1898) II. C. elegans F19H8.2. Homozygous. Outer Left Sequence: TTCCCATTTTGCGATTTCTC. Outer Right Sequence: GGTCAAGTGTAAGCCTTGCG. Inner Left Sequence: TGCTGACAATGTGGAGCAGT. Inner Right Sequence: TCGTGTCATCGAGACCACTC. Inner Primer PCR Length: 2127 bp. Deletion Size: 738 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1582 Y75B7AL.4(ok1935) V. C. elegans Y75B7AL.4. Homozygous. Outer Left Sequence: TATTTACCGTCGGCGTATCC. Outer Right Sequence: TTTTCGACATTTTTACCGGC. Inner Left Sequence: GTGGCGACGACTCTTCTTTC. Inner Right Sequence: CGTCGAATATCGCTCAAACA. Inner Primer PCR Length: 2346 bp. Deletion Size: 814 bp. Deletion left flank: CTCGCTCACGTTGATGCTCGGATATGAGAA. Deletion right flank: GTGTTGAGATTTTCAAAATTCAACTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1586 hil-4(ok1945) V. C. elegans C18G1.5. Homozygous. Outer Left Sequence: TCTTCAACGCGTCTGTCATC. Outer Right Sequence: CAGGATCATCTCCGCAATTT. Inner Left Sequence: TTAATGGATCGCTCCCAAAG. Inner Right Sequence: CGTTTGTTTGCTTCCATGTG. Inner Primer PCR Length: 2808 bp. Deletion Size: 1433 bp. Deletion left flank: CTGAAAATGTGTTCTTATAATTTGATTTCG. Deletion right flank: AAGGTCACCAAGTCTCCAGTCAAGAAGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1587 srh-268(ok1946) V. C. elegans C54F6.1. Homozygous. Outer Left Sequence: TGTATTTTGGGTGCACATCG. Outer Right Sequence: GAGGACGCGATCAAGCTTAC. Inner Left Sequence: TTCCACACCCTCGATAGGAC. Inner Right Sequence: CATGGCGGAAATGGTAAGTT. Inner Primer PCR Length: 3050 bp. Deletion Size: 1421 bp. Deletion left flank: TAACTTCCATGTTTGGTGTATGGTTTTAGA. Deletion right flank: TTCTCGTCTATTATGTCTTTATGATCTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1589 mls-1&H14A12.6(ok1948) III. C. elegans H14A12.4, H14A12.6. Homozygous. Outer Left Sequence: ATCATCGCTGGTCTTGATCC. Outer Right Sequence: GAGTCTTTCGTTGCGAGACC. Inner Left Sequence: TCATTGAAAAGGAACCCTCG. Inner Right Sequence: TTTACCCTTCCCGTTGACAC. Inner Primer PCR Length: 2285 bp. Deletion Size: 1183 bp. Deletion left flank: ATAGTTGAAACATTTTTGACTGTAATTAAA. Deletion right flank: TGAATCGTGACTTTTCCGACAAACCGGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1590 pax-1(ok1949) V. C. elegans K07C11.1. Homozygous. Outer Left Sequence: GGAAAACATCGTGTGCCTTT. Outer Right Sequence: GTCTCAAGGCGAGAAGTTGG. Inner Left Sequence: ATTTGCGCGAATAACTGGTC. Inner Right Sequence: GCCAAAGCTTATCCCATTGA. Inner Primer PCR Length: 2358 bp. Deletion Size: 1165 bp. Deletion left flank: AACCAACAATCATATTCCCACCGGCTGGTT. Deletion right flank: AATGAATTAAATCAAATTTCTGGAAATCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1594 str-61&F14F8.8(ok1959) V. C. elegans F14F8.1, F14F8.8. Homozygous. Outer Left Sequence: TTTTCCCAACGTAGTGAGCC. Outer Right Sequence: GCCACAGGGTACGATAGCAT. Inner Left Sequence: AGGTTTTCAAAGTGCGTTCC. Inner Right Sequence: GCACAAAATCTCCCCCACTA. Inner Primer PCR Length: 2153 bp. Deletion Size: 1443 bp. Deletion left flank: AAAAAATTCTTAAAGATTCTGGAAGTTTTC. Deletion right flank: TATCCGGGCCGGCATCTATCTGCTTAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1597 C04G2.5(ok1962) IV. C. elegans C04G2.5. Homozygous. Outer Left Sequence: CCCATAGAGCCCTTGTGAAA. Outer Right Sequence: GGAGCAAAACAGCTTTCAGG. Inner Left Sequence: CCTTCACGAATCGCTTTCAT. Inner Right Sequence: CTCGATTGGAAGGTTCTTGC. Inner Primer PCR Length: 2140 bp. Deletion Size: 1471 bp. Deletion left flank: CTTCACGAATCGCTTTCATTAGTAATCCTT. Deletion right flank: AACTCACATTTATATCACAGAAACGATCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1601 T25G12(ok1973) X. C. elegans T25G12. Homozygous. Outer Left Sequence: GAGATAGGCAATCCCGAACA. Outer Right Sequence: GTCGACGTGTCATTTTGTGG. Inner Left Sequence: AGTGCGATGTGACGAGTCTG. Inner Right Sequence: CAAGCTAGATGTGATGGCGA. Inner Primer PCR Length: 2152 bp. Deletion Size: 871 bp. Deletion left flank: TTACATTTCCATTCTTTCAGACTAACTAAAGCGTA. Deletion right flank: AAAATTTTTTAAAGGTTTGCAACTCTTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1606 ife-1&F53A2.7(ok1978) III. C. elegans F53A2.6, F53A2.7. Homozygous. Outer Left Sequence: TTCGTGAAGCATATTGCGAG. Outer Right Sequence: GCCCCTTGATAGTGATTCCA. Inner Left Sequence: CCATTTCCTATTTTCCCCGT. Inner Right Sequence: GTATTGTGCGCCCAACTTCT. Inner Primer PCR Length: 2150 bp. Deletion Size: 1047 bp. Deletion left flank: TGCTCCAGTCGCCGAGAAATCCGCCGTCTA. Deletion right flank: TGGGACAGACTGCAGAGAAGTTGGGCGCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1607 pef-1(ok1979) III. C. elegans F23H11.8. Homozygous. Outer Left Sequence: GTCGATTTCCGGTGTGTTTT. Outer Right Sequence: ACGTTGCTGAAATTTTTGGG. Inner Left Sequence: GAAACCGTGCTTTTCAAGGA. Inner Right Sequence: TTTGCCGGAAACTTCAATTC. Inner Primer PCR Length: 2991 bp. Deletion Size: 1552 bp. Deletion left flank: TGCCTACTATTAGCAATTGTGAAGAACCAA. Deletion right flank: AAAACAACGATATGCTACAAAAAATTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1609 nlp-5(ok1981) II. C. elegans F35C11.1. Homozygous. Outer Left Sequence: AGATGCCGACGTCAATTTTC. Outer Right Sequence: ACTGTTGGGCCATACTCGAC. Inner Left Sequence: AATTCGGCTCAAAAAGCTCA. Inner Right Sequence: AGGGACCGAAGAGTGGATTT. Inner Primer PCR Length: 2278 bp. Deletion Size: 1477 bp. Deletion left flank: GCGTTCCAAATTTTATATCAACGGTTGATG. Deletion right flank: AAATTAATTTACCAGTTTATTGTATTGTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1616 C04D8.1(ok1988) III. C. elegans C04D8.1. Homozygous. Outer Left Sequence: CTGCCACGTCAAAAGAGGAT. Outer Right Sequence: AGCGTTTCCCTCAACTCTCA. Inner Left Sequence: AGGCCATGATGATCCAGAAG. Inner Right Sequence: GTTGACCAGGAAGATGGGAA. Inner Primer PCR Length: 2938 bp. Deletion Size: 1479 bp. Deletion left flank: CAGTTTGTGTAAGTGTGTATGTGGTCATTT. Deletion right flank: TATTATCCAATACTTTTTAACTACTGTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1625 par-1(ok2001) V. C. elegans H39E23.1. Homozygous. Outer Left Sequence: ATGTCGGCGGCTGATATTAC. Outer Right Sequence: ACGGAGTCAATTTTTGACGG. Inner Left Sequence: GAGTGAACGAGAAAAAGGCG. Inner Right Sequence: CCACGTCAATCCGAGAGTTT. Inner Primer PCR Length: 2534 bp. Deletion Size: 594 bp. Deletion left flank: ACACTTTTCGCTTCGGGATCAGAGATTCCT. Deletion right flank: TCATTCGATGCTGACTGCTTGCGGGGCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1632 T02E9.1(ok2008) V. C. elegans T02E9.1. Homozygous. Outer Left Sequence: TAAGCTCAACAGCTGCCTCA. Outer Right Sequence: CCAGATGAGACCTCTTTCCG. Inner Left Sequence: GCATCGATTTTGTTCGCTTT. Inner Right Sequence: GGTCAGTGGGATACGGATGT. Inner Primer PCR Length: 3079 bp. Deletion Size: 1209 bp. Deletion left flank: TTCTTTTGTCTTTCATTTTCCCTTCACACG. Deletion right flank: GAAATCTCCAGAAGAAAGTGACGACAAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1636 suf-1&F28C6.8(ok2013) II. C. elegans F28C6.6, F28C6.8. Homozygous. Outer Left Sequence: AGTGCAATTATGGGTGGAGC. Outer Right Sequence: ACGGTAGATGCAACAGGGAC. Inner Left Sequence: TCCATTCAAACCACGAGTCA. Inner Right Sequence: TTCATCATCTCCCTTTTCCG. Inner Primer PCR Length: 2510 bp. Deletion Size: 1673 bp. Deletion left flank: ACTTGTTTTATTGGACCATTTATCAATGTG. Deletion right flank: TCCACCTCGAATGCGGGAATCTCAGAACCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1647 ntp-1(ok2036) IV. C. elegans C33H5.14. Homozygous. Outer Left Sequence: TTTCCTAATGTCGGGGTGAG. Outer Right Sequence: CAACGGTGAGCACTTCAAGA. Inner Left Sequence: GCCGAATTTGTTGCACTGTA. Inner Right Sequence: TGGAAAGCATGATGAACCAA. Inner Primer PCR Length: 3523 bp. Deletion Size: 2298 bp. Deletion left flank: TCCTAGAGCCCATTGCATTTCTTCACCGGC. Deletion right flank: TTAGATCTTCAATGAAATTGGTCAGAAAAA. Insertion Sequence: GTGATCTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1665 K11H12.1(ok2063) IV. C. elegans K11H12.1. Homozygous. Outer Left Sequence: CCATGGGACAGACTGGAACT. Outer Right Sequence: CAAACCTACGGAAAGCCAAA. Inner Left Sequence: CTCGAGGGAAGCAGTGACTC. Inner Right Sequence: AGGATCCCAAGCCAAGAACT. Inner Primer PCR Length: 2167 bp. Deletion Size: 1116 bp. Deletion left flank: TACAACTAAAATCGAGCCGCGGCGCGCCGT. Deletion right flank: GAAAAATTGGTAAAGCCTATGAAAAAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1676 D2013(ok2083) II. C. elegans D2013. Homozygous. Outer Left Sequence: TCTCAAAATGCCCATCCTTC. Outer Right Sequence: CGCATCATTGTTTCATCACC. Inner Left Sequence: TGGTGACACTGGATGAAGGA. Inner Right Sequence: TGTTCCCCAGAAGAATGGAG. Inner Primer PCR Length: 2586 bp. Deletion Size: 574 bp. Deletion left flank: CCGAAGAGCCGTTTTCTAAATAATATACAC. Deletion right flank: TAAGAGGCTTTGTTGTAGTAAAAATCCTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1691 R02F2.5(ok2104) III. C. elegans R02F2.5. Homozygous. Outer Left Sequence: GTCAACAACCGTCTCCAGGT. Outer Right Sequence: CAATGAAATCGGCGAAGAAT. Inner Left Sequence: CACCAAAATTTATCCACGGG. Inner Right Sequence: GAGGAATAGTCTGAACGCGG. Inner Primer PCR Length: 2336 bp. Deletion Size: 815 bp. Deletion left flank: CAAAATTTATCCACGGGAAGTGTCGACTGC. Deletion right flank: AAGCTGCTCCCGTGGTCTATGGATCCCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1695 gst-42&D1053.2(ok2108) X. C. elegans D1053.2, D1053.1. Homozygous. Outer Left Sequence: GTCCAAAATTCCCTGACCCT. Outer Right Sequence: CAGTTCTAGTCAGCTCCCCG. Inner Left Sequence: TCTCCGACAGCATACTTCCC. Inner Right Sequence: CAGCTTCATCCCAATCCCTA. Inner Primer PCR Length: 2135 bp. Deletion Size: 1304 bp. Deletion left flank: CCAGAATGTTGCTTTAGAAGAATTTCAAGA. Deletion right flank: TCATCAGAGTCGATTGTTCCACGTCCCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1726 tab-1&F31E8.5(ok2198) II. C. elegans F31E8.3, F31E8.5. Homozygous. Outer Left Sequence: GCACAAGTTGTTGGGGAAGT. Outer Right Sequence: TTTTTGTCTGGGGTTGGAAG. Inner Left Sequence: TCTTTCACGGGACCTTCATC. Inner Right Sequence: ATCGGAGAACACAAGTTGCC. Inner Primer PCR Length: 2481 bp. Deletion Size: 1702 bp. Deletion left flank: TAAAATATGTAAATTTGATCATCAAAAATT. Deletion right flank: TCAATCCTCCAACGGATTCACATGTCTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1731 T21B10.1&enol-1(ok2210) II. C. elegans T21B10.1, T21B10.2. Homozygous. Outer Left Sequence: GTCGAAGCTCAAAAGGTTGC. Outer Right Sequence: GAAAGAGTGACGAAGGTCGC. Inner Left Sequence: GTCACAAGACTCCGTGCAGA. Inner Right Sequence: CATGCCGAGAAGAAAAGAGG. Inner Primer PCR Length: 2467 bp. Deletion Size: 1161 bp. Deletion left flank: GAGAATCCACACAAGTTACTGCTTCAGCTG. Deletion right flank: TAATGGGGTCTGCCGTGCCTTTTTTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1748 eat-4&ZK512.7(ok2233) III. C. elegans ZK512.6, ZK512.7. Homozygous. Outer Left Sequence: ACAAATGGTTGGAGAGCCAC. Outer Right Sequence: ATGCAGCTTCTCCTCCAAAA. Inner Left Sequence: AGCCCAACACAACAAAAAGG. Inner Right Sequence: GGATCTTGTTGGATCGGAGA. Inner Primer PCR Length: 3386 bp. Deletion Size: 1329 bp. Deletion left flank: TACAGCACTCTTTTTTCAGGGAGTTTGTTA. Deletion right flank: GTGCTAAAATGCCTGAATATCGTAGTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1749 numr-1(ok2239) III. C. elegans F08F8.5. Homozygous. Outer Left Sequence: CACAAAGAGCATGCCTTGAA. Outer Right Sequence: GGTCTGAAATCTGGAGAGCG. Inner Left Sequence: GACAAAATGCGGAACGTCTT. Inner Right Sequence: GTTTGCAGATCCCAATTCGT. Inner Primer PCR Length: 2296 bp. Deletion Size: 975 bp. Deletion left flank: CGTAAATGAAAACAAATTTTGATGGAGATT. Deletion right flank: CTGAGACATTGAAATCAAATTTCCTTTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1753 fbxb-56(ok2243) I. C. elegans YY63D3A.10. Homozygous. Outer Left Sequence: AGGTGGAAGGGATGGCTATT. Outer Right Sequence: GCTTCCTTGACTCTCCGTTG. Inner Left Sequence: GAAATTTGCACTCCAGGGAA. Inner Right Sequence: TAGTCTGGAAGGAGCGCTGT. Inner Primer PCR Length: 3267 bp. NOTE: External left primer occurs twice in Y63D3A, once at coordinate 1234 and once at coordinate 3721, giving external WT products of 3493 and 1006 bp respectively. Shorter product is apparently preferred in PCR. Reactions on mutant template using ok2243_external primers thus primarily gives a product from EL(3721) and ER. Nested amplification on this product using ok2243_internal primers appears to give a product from EL(3721) (remaining primer from the external round passed to internal round by product transfer) and IR. Deletion Size: 219 bp. Deletion left flank: CCACTTCAGTCTTGATGCTGCGCTCGTGCC. Deletion right flank: TGTCACTAGCTCTATATTCAAGTCTCCTCG. Insertion Sequence: TTTTGTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1783 C16C8.21(ok2301) II. C. elegans C16C8.16. Homozygous. Outer Left Sequence: AAGACGACCACACTCTCGCT. Outer Right Sequence: ACACTGGGAAAAATGTTCGG. Inner Left Sequence: TGCCGATACTAAAGTTCCCG. Inner Right Sequence: GGACTACGGTAGGTGGCAGA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1331 bp. Deletion left flank: ATTGTTCGAAAATTTGATGTCGGAATTGAA. Deletion right flank: GACTGTCAAAGCCGAGCTGAATGTGACGAA. Interpretation of sequence data is very speculative, and should be confirmed independently. Predominant band in PCR of mutants, about 600 bp, is probably not the full-length mutant product. Full-length mutant product is more likely a fainter band of about 1770 bp, which correlates well with deduced breakpoints and relative sizes of various bands produced by single-round amplification with external and internal primer pairs. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB50 okIs46 I. C. elegans okIs46 I. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB5000 dpy-1(ok5083) III. C. elegans Whole-genome sequenced strain. Dpy. It has not been confirmed that this phenotype is the result of ok5083. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to ok5083, it is homozygous for 196 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
RB5001 Whole-genome sequenced strain. C. elegans Whole-genome sequenced strain. Dpy. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 289 mutations determined from sequence data, all of which are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
RB5002 Whole-genome sequenced strain. C. elegans Whole-genome sequenced strain. Unc. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 477 mutations determined from sequence data, all of which are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
RB51 okIs47 X. C. elegans okIs47 X. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB525 pgl-3(ok257) V. C. elegans C18G1.4a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB56 okIs52 II. C. elegans okIs52 II. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB567 svh-5(ok284) X. C. elegans C33A11.4/tag-97. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB570 srgp-1(ok300) IV. C. elegans F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB58 okIs54 V. C. elegans okIs54 V. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB592 srp-6(ok319) V. C. elegans C03G6.19. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB595 unc-73(ok322) I. C. elegans F55C7.7d. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB60 okIs56 II. C. elegans okIs56 II. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB607 nlp-12(ok335) I. C. elegans M01D7.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB608 tag-96(ok336) IV. C. elegans M01D7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB61 okIs57 X. C. elegans okIs57 X. Pharyngeal GFP element integrated near unc-3 Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB62 okIs58 III. C. elegans okIs58 III. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB622 fzr-1(ok380) II. C. elegans ZK1307.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB625 EEED8.6(ok382) II. C. elegans EEED8.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB626 gcy-37(ok384) IV. C. elegans C54E4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB665 dop-1(ok398) X. C. elegans F15A8.5. [NOTE (10/28/11): Possible heterozygous strain; genotype being confirmed by Moerman Lab] Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB67 okIs63. C. elegans okIs63 . Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB68 okIs64. C. elegans okIs64 . Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB69 okIs65. C. elegans okIs65 . Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB719 ephx-1(ok494) II. C. elegans K07D4.7a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB728 tre-1(ok327) I. C. elegans F57B10.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC100 unc-112(r367) V; gkDf2 X. C. elegans gkDf2. Multiple genes deleted. Deletion extents determined by oligo array CGH. Deletion size: ~44kb. Deletion left flank: TTAGTAAGCCGGAAAATGGATTTCGCTTTTCTCCTATTGAGAAACCTAAA. Deletion right flank: CTACCTTTCAAAATGAATAGCAACCACTTTTTCGACGAAGAAATGTTCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1000 C04E6.5(ok1497) V. C. elegans C04E6.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10002 bli-2(e768) F10E7.2&spon-1&F10E7.11(gk460) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F10E7.2, F10E7.4, F10E7.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk460 homozygotes (probable embryonic arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AACAATGTTTGGTCCATCCC. External right primer: ACACCAGGTTGACCTCCTTG. Internal left primer: ATGAGCCCAAATGAACCAAC. Internal right primer: AATAGGCACAATACGCCTGC. Internal WT PCR product: 5051. Deletion size: 4507 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10005 ast-1(gk463) bli-2(e768) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk463 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10007 bli-2(e768) C06A8.1(gk465) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans C06A8.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk465 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTGCAATCGGAGTGGTTTC. External right primer: GGGAATCATGCCAATTATGG. Internal left primer: GGTCATGAAGCATTCGAGGT. Internal right primer: GAACAGAGCGTTGCATTGAA. Internal WT PCR product: 718. Deletion size: 141 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1001 trpl-5(ok1499) II. C. elegans T16A1.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1002 tag-344(ok1500) I. C. elegans B0511.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1003 vha-3(ok1501) IV. C. elegans Y38F2AL.4. Superficially wild type. External left primer: GGTGAAAAATCGGGGAAAAT. External right primer: GCGATGACAACTATTGGGCT. Internal left primer: TTTAGCTCAAAATTTGCCCG. Internal right primer: ATGTGCTGCGACTTCCTTCT. Internal WT amplicon: 2580 bp. Deletion size: 710 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1004 cdl-1&tag-209(ok1471) II. C. elegans R06F6.1, R06F6.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1006 cbp-1(ok1491) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans R10E11.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, Bli non-GFP (hT2 homozygotes), and non-GFP ok1491 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10067 F31D5.1(gk770) gkDf13 unc-4(e120) II. C. elegans This strain is homozygous for two deletions plus unc-4(e120). The deletions were identified by comparative genome hybridization (CGH) of a mutangenized unc-4 line against N2. The deletion gk770 was confirmed by PCR and sequencing of the amplification product, and is detectable using the following primers. Left primer: GCGCATTTGCAACATCTCTA. Right primer: AACCTCAACGGAAACACTGG. WT amplicon: 1087 bp. Deletion size: 142 bp. Deletion left flank: CAGGTGAGCTTAAGCAGATTTTTTTTTGAA. Deletion right flank: GTGAGCCAAGTTAAACATTTGAAAATAATT. Insertion Sequence: GTGAGCCAAGTTGAACATTTGAAAATAAT. The deletion gkDf13 was not confirmed by PCR. CGH data indicates a maximum size of 7801 bp and a minimum size of 1357 bp. Left flanking probe: GTTTTATCTTTCGGCTTATTCAGAATAAATTATTGGTTCAGTTGTTTCAG. Left deleted probe: AGGAGAAGGAGATAAATGGTCTTGTAGACTGCGCAGCTAGGGAGAGAGAA. Right deleted probe: GAAGTTCTGAAGATTCAATTTTCAGTCTTACAATATTCAGTTCTCGTGTA. Right flanking probe: GTTGAATTTATTCGAATTTTGCAATTTCAGCAAAACACCTTTATCTTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10068 unc-4(e120) sre-29(gk771) II. C. elegans F57G9.4. Unc. External left primer: GACCTGAAATTGCTGGGAAA. External right primer: GGAAACTCACAAATTGCCGT. External WT amplicon: 1532 bp. Deletion size: 161 bp. Deletion left flank: CCCTCTCCACCGCAATTGCAAGAACTCCAA. Deletion right flank: GCTATAGTAATCAATTTTCCAATTATAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1007 C10H11.8(ok1413)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans C10H11.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1413 homozygotes (arrest stage/phenotype undetermined). Homozygous ok1413 males are segregated, but homozygous ok1413 hermaphrodites have not been isolated. Pick WT and check for correct segregation of progeny to maintain. External left primer: GGCAGCTGGGATTTATTCAG. External right primer: GCGTGGAGAAACAAAATGGT. Internal left primer: GAATCAGTCGTGGGCATTTT. Internal right primer: ATTCGCGTTTTGCTTGAAAT. Internal WT amplicon: 2524 bp. Deletion size: 770 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10070 K05F1(gk773) unc-4(e120) II. C. elegans K05F1. Unc. External left primer: GTATGGTCCGTCGCAAGAAT. External right primer: CTGATGACGGTTTTCCTGGT. External WT amplicon: 1653 bp. Deletion size: 490 bp. Deletion left flank: CCGCCAAATTTGGCGGTTTCTGAGACCTTG. Deletion right flank: CTCGCATACGCTTGAAACTTACAGCGTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10071 srb-16(gk774) unc-4(e120) II. C. elegans F58A6.6. Unc. External left primer: AAGTGGTTTTGGGTCTGACG. External right primer: GTACCGCCGCAAGAATGTAT. Internal left primer: GCCGCCACGAGTTAATAGAA. Internal right primer: TGTTGGCCCTGATTTCTTTC. Internal WT amplicon: 4857 bp. Deletion size: 3522 bp. Deletion left flank: ACGATTTTTGCACAAAAAACCCCTCCAAAC. Deletion right flank: GTCGTTTGCTTGTTTCATCTTCATCATTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10072 cpna-2(gk775) unc-4(e120) II. C. elegans B0228.4. Unc. External left primer: GCTCAAAGCTCCGAAACAAC. External right primer: CCCACAAGATTGGTAAGCGT. External WT amplicon: 876 bp. Deletion size: 153 bp. Deletion left flank: AGTTAGACACACTGAAAATGCTGGAAAGGT. Deletion right flank: CAGAAGCCTTGCTCCGTCGGCATCTGAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10073 T28D9(gk776) unc-4(e120) II. C. elegans T28D9. Unc. External left primer: CATTTCGGAACGTTTCCATC. External right primer: TCTGCTTCGTACTTTGCTGC. External WT amplicon: 1121 bp. Deletion size: 436 bp. Deletion left flank: TTTTTTACGTGAATCTTTTTTTTTTCAGAA. Deletion right flank: CAAGTTGTGAATTTTCGAACATCCGTCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10075 T05A6.4(gk777) unc-4(e120) II. C. elegans T05A6.4. Unc. External left primer: GCAATCCTTCAAGTTCCCAA. External right primer: ACGACTTGCAGATGGTTGTG. External WT amplicon: 902 bp. Deletion size: 140 bp. Deletion left flank: GGGCATGTAAAAGTGTGCTTGTCTTTCATA. Deletion right flank: TACCACCATTTTTTTTTCATTTTTGGATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10077 unc-4(e120) Y46E12BL.2(gk801gk909) II. C. elegans Y46E12BL.2. Unc. External left primer: ATCCACAATGCTCCGATCTC. External right primer: TCTGGCTTGCTTTTGTGATG. External WT amplicon: 540 bp. This strain contains two point mutations in Y46E12BL.2. The first is gk801, which is a G->A mutation at Y46E12BL coordinate 21938 (flanking sequences GTTCTTGAAGCTATACGGCTTTACACAGAA and TTACTCCAGCCGATCTGGTCACCCGTTATG). The second is gk909, which is an A->G mutation at Y46E12BL coordinate 21966 (flanking sequences AAGTTACTCCAGCCGATCTGGTCACCCGTT and TGTCGATAGTGCGATCGCCAAGTCCAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10078 syd-1(gk802) unc-4(e120) II. C. elegans F35D2.5. Unc. External left primer: TCAACGTTGTCGCTGATCTC. External right primer: CCTCAAATTCACGGAATGCT. External WT amplicon: 543 bp. This strain carries a point mutation in F35D2.5. The mutation is gk802, which is an A->T mutation at F35D2 coordinate 23221 (flanking sequences TCGACCAACTCACTAACTCTTGAGGGCCAT and TCGACAAAATCATTTGGAGACTTGAAGATG). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10079 unc-4(e120) mix-1(gk803) II. C. elegans M106.1. Unc. External left primer: GTTGAGGAAGCAGCTGGAAC. External right primer: TTCTTCGCAGCAGTAATCCC. External WT amplicon: 815 bp. This strain carries a point mutation in M106.1. The mutation is gk803, which is an A->G mutation at R06F6 coordinate 40587 (flanking sequences CACAAAATACCGTAATGACCTCGAATCCCT and ACGAGAGGAACAATTGCTAATGACAAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10080 C06B8.3(gk783) V. C. elegans C06B8.3. Superficially wild type. External left primer: GACATGGTTCTATCCGCCAG. External right primer: GCAGAAGGCAAAAGAGCATC. External WT amplicon: 452 bp. Deletion size: 81 bp. Deletion left flank: CTGTCAATGTGAACCCTGGACTGACGGAGT. Deletion right flank: AGGTCATTTGGGAGTCCTACAAACTTCTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1010 Y66H1A(gk424) IV. C. elegans Y66H1A. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10109 K05F6(gk907) unc-4(e120) II. C. elegans K05F6.2. Unc. External left primer: ACAAATTCCCTTTGTCGTCG. External right primer: TGGATGAGCAGCTGGTAAGA. External WT amplicon: 200 bp. This strain carries a point mutation in K05F6.2. The mutation is gk907, which is a T->A mutation at K05F6 coordinate 21364 (flanking sequences AAATCAAAAACTCTGTTTGATGGATATCTA and ATGCCTTTAAATGATCTACTTCTTACCAGC). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1011 acdh-1(ok1489) I. C. elegans C55B7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10110 let-19(gk908) unc-4(e120) II. C. elegans K08F8.6. Unc. External left primer: TCAATGCCTGGAGATGATGA. External right primer: CCCGCCTTCTTTATCTGTTG. External WT amplicon: 434 bp. This strain carries a point mutation in K08F8.6. The mutation is gk908, which is a G->A mutation at K08F8 coordinate 36647 (flanking sequences AATGGTTGAAGAAAGCAAGAAGGAAAGTTA and CAAACAACAGATAAAGAAGGCGGGGCAGTA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10116 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in M01D1.2 (gk1188), identified by CGH (Comparative Genome Hybridization). Minimum deletion size: 345 bp; maximum size 5952 bp. Left flanking probe: TGAAATCGGTGAGCTTTTGGTCTGGGTAAGCTCTCAGGAGGAGCCAGCCT. Right flanking probe: CTATTCAACCCCCATGCGTTGGATGAAGCCTTCCCAATGTCCAACCTTTA. Left deleted probe: AAGCCCTGCGATCACTGGTAAGCTCCTGATCACCCTATTACTTGCACAGT. Right deleted probe: AATCGCAGAGATTGTCAGCGACTTGAAGCTCGGCGGATTGGACAGGCCGT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10118 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC1012 +/mT1 II; pxl-1(ok1483)/mT1 [dpy-10(e128)] III. C. elegans C28H8.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1483 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10123 R11G1.6(gk1190) X. C. elegans R11G1.6. External left primer: GAGACGTTGAAGTACGCGCT. External right primer: CCGAAAATTCGAAAGCGTAA. Internal left primer: TTACCCAGAGACCGAACTGC. Internal right primer: CTTCATCGCCCTCTTTCCTT. Internal WT amplicon: 838 bp. Deletion size: approximately 200 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: AAAGGATCACCCACAGCATCTCTCCAAACAGCCAACCCAAAACTAAAATT. Left deleted probe: AAAACAATGAGTACGGATTCAAAAATAAAACCTTGTAGGAAACTTGTGTA. Right deleted probe: GGATTCGATGGCATCTGTATAGAGTTGAATGGCATAATTATAGGCATTTA. Right flanking probe: GAAGCGATTCGAATCGTTCTCCCGACAACATCTTAGGAACAACGGCCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10124 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in B0310.1 (gk1191), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: GAATCCGAGAAAAGCGTCTG. External right primer: GATCTTTTGGCCTTTTGCTG. Internal left primer: TCATCCACGTAGACTTGCCA. Internal right primer: TTGCAATCCTGAAGCAAATG. Internal WT amplicon: 2706 bp. Maximum deletion size: 1911 bp. Minimum deletion size: 881 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: CAAAACGCGTGTTAACCCTGTGCCATCTGTCTGATCCGACTCAGAAAACA. Left deleted CGH probe: TTTCTGAATACAAGAGAAGAGCATAATGGGCGCTGATCTTCCACCGAAAT. Right deleted CGH probe: AATACATTTAAGCTACACACCTACTTGCCTGCTCTCAGTGTGACCGAAAA. Right flanking CGH probe: AAGTTTATGGGCCTGAAACAATTGTATTTTCGTATCTTGACATTGATAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10126 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10127 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F19C6.1 (gk1192), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: CGAACTCGCCGTTCTACTTC. External right primer: GTTTTAGCGGCTTCAACTGC. Internal left primer: CGTCCCTTGATTGGTTCATT. Internal right primer: GATTCTCATTGGCAGACGGT. Internal WT amplicon: 3924 bp. Approximate deletion size: 2575 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: TTCGTTCAAGCTTAATGTTTCAGCATGCCTCTTCTTGACTCGCTTCTTTT. Left deleted CGH probe: TCCGGTACCAATTGTCGACTTGCTACCATTTTACGACCGCACAACTAAAA. Right deleted CGH probe: TAGTGAGGGAACTGTAGATAATTCTTCCACTTTTTGCTTTTTCCTTTCTT. Right flanking CGH probe: TACCGTATTGGCAACGATATTTTCAATCTCCATGGTCCTATCGTGGCTGA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10128 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10129 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC1013 C08F8.1(gk526) IV/nT1 [qIs51] (IV;V). C. elegans C08F8.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk526 homozygotes (variable arrest, late larva to sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10130 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10131 fbxc-44(gk1193) II. C. elegans C16A11.6. External left primer: TCCACGGGAATTTCTACTGC. External right primer: CGCAAATTTTTCCGTGTTTT. Internal left primer: CTCCTTCAATCCAGCTTTCG. Internal right primer: AGACAATTCCGCCAACAATC. Internal WT amplicon: 3801 bp. Approximate deletion size: 1600 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: CGATAAATCGTTCGATTAGGGGGTTATCCGATGACCGAGTCATGAAATGT. Left deleted probe: CATAAACCGCCAAGGTTCGTGAATCCTGTGCGACGCCAACTTAAATTAGT. Right deleted probe: TGAAATTTCGAACCTTGAACTTCTTAAATGACTGGGGCAGCTCAAGAATA. Right flanking probe: AAAATGCGTGCGGCGCGTTGCAACTTAGCTCCGCCCACCCTTTGAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1014 dgk-1(ok1462) X. C. elegans C09E10.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1015 ari-1.4(gk432) IV. C. elegans Y73F8A.34. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1016 szy-4(ok1416)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans C30B5.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1416 homozygotes (sterile adult, explodes at vulva). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10165 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F42A10.1 (gk1194), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: TGGCTTTGCAATCTGTTGAG. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: ACTTGATTCTTGACGAGCCT. Internal right primer: CAACTGATAAGAGTGGTTCGCA. Internal WT amplicon: 906 bp. Maximum deletion size: 137 bp. Minimum deletion size: 101 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking probe: TTTTGTTTCGCATTCGGTTGTTTCCCATATTTCACCCAGTTTCCACGTTT. Left deleted probe: TATTAAATTGTTCACTTCAAAATTTAAGTATGAGTGAGAGCTCTAGCCTG. Right deleted probe: AAATAATGCAAAGGTCTTCCTTGCTCGGGTCATCATGAAGAAGATACTCG. Right flanking probe: GGGTCATCATGAAGAAGATACTCGAGTTGGTAAGGCTTATCGTTCTGAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10166 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries homozygous deletions in C26C6.1 (gk1195) and F14D12.6 (gk1196), identified by CGH (Comparative Genome Hybridization), and confirmed by PCR but not sequenced. The deletions can be detected by the following primers. gk1195: External left primer: ACGGAAGTTCTCAAAGCGAA. External right primer: TCGTCTTCAGCAGTGAATGG. Internal left primer: GCAGGCTCTTCAATGTACGA. Internal right primer: TCTCGGAAAGGCGTAAGAAA. Internal WT amplicon: 506 bp. Approximate deletion size: 100 bp. gk1196: External left primer: CCGGGAAATCACAGCACTAT. External right primer: TACGAATGCAGCGACAGAAC. Internal left primer: AGGATTCACGACGAATGTCC. Internal right primer: CTTCTCGGTAACTTCGCCAC. Internal WT amplicon: 1785 bp. Approximate deletion size: 900 bp. gk1195 left flanking probe: GATGAGGAGGGAGGAAACAAACCGGCGATGGTGAAAAGACATGTAGGATA. gk1195 left deleted probe: TTTCTGCATGTTATTAATTAAATTCTTTTCAGGAAAGCGAAGTCGAAATG. gk1195 right deleted probe: ATATGTGGCACCATGTTACGCATACGTTTCCCGATCTGACGAGAAGAAAA. gk1195 right flanking probe: ACGCATACGTTTCCCGATCTGACGAGAAGAAAACTCCTCTTCACATTTTC. gk1196 left flanking probe: AGCAACCGACATCTGGACGACACGTCGCCGTAGCTCCTTTTGAGTGACGT. gk1196 left deleted probe: GCTCAAATTGCAAACTAGTTTTCATTTGTAGAACTCCATGAGTGGATGAA. gk1196 right deleted probe: TCTCTGTTTCCTTCAGTCGCTGCCTACTATGACGGATGGTTATACTGTAG. gk1196 right flanking probe: CTATGACGGATGGTTATACTGTAGATTTTGGCATAAACGATGATGAGAAT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC1017 tag-335(ok1455) IV/nT1 [qIs51] (IV;V). C. elegans C42C1.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1455 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1018 +/szT1 [lon-2(e678)] I; gck-4(ok1352)/szT1 X. C. elegans C04A11.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1352 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1021 K07A12.2(ok1506) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K07A12.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1506 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1022 nhr-154(gk527) V. C. elegans C13C4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1024 pdr-1(gk448) III. C. elegans K08E3.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1025 rin-1(gk431) V. C. elegans C48G7.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1026 rab-10(ok1494) I. C. elegans T23H2.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1027 daf-15(ok1412)/nT1 IV; +/nT1 V. C. elegans C10C5.6a. Homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and ok1412 homozygotes (arrested incomplete dauers). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1028 gid-8(gk435) V. C. elegans F53E2.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807. gid-8 formerly known as tag-304.
VC1029 ccar-1(gk433) IV. C. elegans Y37A1B.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1031 sup-26(gk403) III. C. elegans R10E4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1032 pfd-4(gk430) IV. C. elegans B0035.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1033 cul-4(gk434)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk434 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1034 cir-1(ok1488) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F55F8.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1488 homozygotes (thin, late larval or early adult arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1035 rin-1(ok1511) V/nT1 [qIs51] (IV;V). C. elegans C48G7.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1511 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1037 cup-2&tag-353(gk443) I. C. elegans F25D7.1, F25D7.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1038 +/mT1 II; set-16(gk438)/mT1 [dpy-10(e128)] III. C. elegans T12D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk438 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1039 ceh-12(gk436) I. C. elegans F33D11.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1040 F42G10.1(ok1518) X. C. elegans F42G10.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1041 lev-8(ok1519) X. C. elegans C35C5.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1042 tag-278(gk439) X. C. elegans C02F12.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1043 pcp-5(gk446) III. C. elegans ZK688.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1044 gly-9(gk440) III. C. elegans Y47D3A.23a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1045 bet-1(gk425) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y119C1B.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk425 homozygotes (sterile with spiky vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1046 +/mT1 II; abce-1(gk481)/mT1 [dpy-10(e128)] III. C. elegans Y39E4B.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk481 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1047 acd-3(ok1335) X. C. elegans C27C12.5. Him, otherwise superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1048 +/szT1 [lon-2(e678)] I; tag-343(ok1464)/szT1 X. C. elegans F43B10.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1464 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1049 C06A8.5(ok1515)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans C06A8.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1515 homozygotes (sterile adult, often with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1050 wdr-12(ok1478) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F55F8.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1478 homozygotes (Dpy, early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1051 mir-34(gk437) X. C. elegans Y41G9A.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1052 unc-43(gk452) IV. C. elegans K11E8.1c. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1053 nhr-154(gk454) V. C. elegans C13C4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1054 C41G7.3(ok1521) I. C. elegans C41G7.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1055 F08A8.5(gk453) I. C. elegans F08A8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1056 E01A2.6(gk528) I. C. elegans E01A2.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1057 tbb-4(ok1461) X. C. elegans B0272.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1059 fbxb-68(ok1520) I. C. elegans F09C3.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1060 tag-348(gk441) V. C. elegans T04H1.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1061 B0303.2(gk457) III. C. elegans B0303.2. Superficially wild type. External left primer: CGCGGTAAATCAGAAAGCTC. External right primer: ATATTTTCAGCACGATCCCG. Internal left primer: TTCAACCATGTCATTTGCGT. Internal right primer: GCACCCAAATCCAGAACACT. Internal WT amplicon: 1716 bp. Deletion size: 631 bp. Deletion left flank: CGGGAGCCTCACACGAACAGAAAGGAGAAG. Deletion right flank: ACAGCAATGCAAATAGTACTCTTCTTTCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1062 C48B6.8(gk471) I. C. elegans C48B6.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1063 nlp-15(ok1512) I. C. elegans CC4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1064 mtx-2(gk444) III. C. elegans ZC97.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1065 Y48G8AL.1(ok1524) I. C. elegans Y48G8AL.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1066 F29G6.2(gk456) X. C. elegans F29G6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1067 ptr-5(gk472) X. C. elegans C53C11.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1068 Y38H8A.2(ok1535) IV. C. elegans Y38H8A.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC107 tts-1(gk105) X. C. elegans F09E10.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1070 mir-84(gk473) X. C. elegans B0395.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1071 M01A8.2(gk470) III. C. elegans M01A8.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1072 F29G6.2(gk455) X. C. elegans F29G6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1073 rabs-5(ok1513) IV. C. elegans Y42H9AR.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1075 T03F6.4(ok385) III. C. elegans T03F6.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1076 C14F11.2(ok1543) X. C. elegans C14F11.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1077 Y56A3A.33(ok1544) III. C. elegans Y56A3A.33. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1078 C43E11.13(gk510) I. C. elegans C43E11.13. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1079 C50F4.16(gk450) V. C. elegans C50F4.16. Superficially wild type. External left primer: TCTCCAGATTGACCGATTCC. External right primer: AATTCGATTCCGGCTTTCTT. Internal left primer: ATCCGGAACACGGTTAACAA. Internal right primer: CGAGACGATGCATGAGAGAA. Internal WT amplicon: 1720 bp. Deletion size: 405 bp. Deletion left flank: CTTCCAGATTGATGAGCACCCACAACAAAT. Deletion right flank: TGATATTTTGATACAAAATCAGTCACAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC108 H32C10(gk36) IV. C. elegans H32C10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1080 che-3(ok1574) I. C. elegans F18C12.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1081 C27H5(gk539) II. C. elegans C27H5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1082 F55C12.1a(gk522)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F55C12.1a. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk522 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1083 fis-2(gk414) X. C. elegans F13B9.8a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1085 dnj-21(ok1577) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T19B4.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1577 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1086 D2013(ok227) II. C. elegans D2013. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1087 acdh-1(ok1514) I. C. elegans C55B7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1088 +/szT1 [lon-2(e678)] I; sto-6(ok1542)/szT1 X. C. elegans Y71H9A.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1542 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1089 mkk-4(ok1545) X. C. elegans F42G10.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC109 apc-11(gk37)/eT1 III; +/eT1 V. C. elegans F35G12.9. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and sterile homozygous gk37 hermaphrodites. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1090 T10H9.3(ok1546) V/nT1 [qIs51] (IV;V). C. elegans T10H9.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1546 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1094 rtcb-1(gk451) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F16A11.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk451 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. May also segregate Bli non-GFP (hT2 homozygotes), which are the result of rare recombination. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCCTTCTTCATCAATTCC. External right primer: ATAATTTCTCGGACCCGCTT. Internal left primer: GCGTAATGATTTCCTGCTCC. Internal right primer: CATCATCTTTCCACCACACG. Internal WT amplicon: 1913 bp. Deletion size: 370 bp. Deletion left flank: ATGATTCACTAACCGAATGTCCAACAATTC. Deletion right flank: ATCTCAAAATCTTTAGTCAAGAAAACATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1095 nhr-62(gk478) I. C. elegans Y67A6A.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1096 kin-3(ok1516) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans B0205.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1516 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1097 pas-1&C15H11.8(ok1531) V/nT1 [qIs51] (IV;V). C. elegans C15H11.7, C15H11.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1531 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1099 hsp-4(gk514) II. C. elegans F43E2.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC110 pus-1(gk38) V. C. elegans W06H3.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1100 Y67D8C.5(ok1575) IV. C. elegans Y67D8C.5. Superficially wild type. External left primer: TTCTCCTGTGACAGCATTCG. External right primer: ATCTCAACAAAAGCCCGATG. Internal left primer: AACGACAGTGTGCGAACTTG. Internal right primer: TGTGCTGGGAGTATGAGCTG. Internal WT amplicon: 3242 bp. Deletion size: 1637 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1103 Y49A3A.4(ok1547) V/nT1 [qIs51] (IV;V). C. elegans Y49A3A.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1547 homozygotes (early larval arrest). Lethal phenotype is suspicious, as deletion appears to affect only intron sequence. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1104 Y37E3.4&Y37E3.5(gk513) I. C. elegans Y37E3.4, Y37E3.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1105 ttll-11(gk482) IV. C. elegans H23L24.3b. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1106 sqd-1(ok1582) IV/nT1 [qIs51] (IV;V). C. elegans Y73B6BL.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1582 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1108 +/szT1 [lon-2(e678)] I; nlp-14(ok1517)/szT1 X. C. elegans D1009.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1517 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1109 spp-10&hlh-12(ok1532) IV. C. elegans C28C12.7, C28C12.8. Often sickly, otherwise superficially wild type. External left primer: TGTCAAGAATGTCATCCCCA. External right primer: TTAAAATGGCGAAGAAACCG. Internal left primer: CCATCTAGCCCCATCTCAAA. Internal right primer: CCGAGATGAACGGAATGTTT. Internal WT amplicon: 2182 bp. Deletion size: 1866 bp. Deletion left flank: ATCTAGCCCCATCTCAAATGCTCACAATCT. Deletion right flank: ACAGTTATTGCGTCTATGTCACTATTTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC111 R13H4.2(gk39) V. C. elegans R13H4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1110 +/szT1 [lon-2(e678)] I; ptr-4(ok1576)/szT1 X. C. elegans C45B2.7. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1576 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1111 +/mT1 II; T12D8.1&T12D8.2(gk445)/mT1 [dpy-10(e128)] III. C. elegans T12D8.1, T12D8.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk445 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1112 cul-4(gk511)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk511 homozygotes (late larval arrest or sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1113 R01H10.6(gk507) III. C. elegans R01H10.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1114 T20G5.12(ok1533) III. C. elegans T20G5.12. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1117 +/mT1 II; paa-1(ok1539)/mT1 [dpy-10(e128)] III. C. elegans F48E8.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1539 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCTGCGTATCACTGTCGC. External right primer: CAGAGTTTTGTCTCGAGGGC. Internal left primer: CTCTTGTTCTCCTCATGCCC. Internal right primer: CTCGGGAACAAAAATGGAAA. Internal WT amplicon: 2209 bp. Deletion size: 621 bp. Deletion left flank: TTGGCGTTGGGTGTGGAGCGCACACGCAAC. Deletion right flank: AAGAAGAAACTCATCGAGCCAATTCTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1118 npp-13(ok1534)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans Y37E3.15. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1534 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1119 dyf-2&ZK520.2(gk505) III. C. elegans ZK520.1. Superficially wild type. External left primer: CTCGCAATTCCAGACTGACA. External right primer: CGGAGTGAAGTATCCGGTGT. Internal left primer: TCTGCGGATTCTCCATAACC. Internal right primer: GCGGCAGTTCCGTTATATGT. Internal WT amplicon: 1950 bp. Deletion size: 403 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC112 ccf-1(gk40)/eT1 III; +/eT1 IV. C. elegans Y56A3A.20. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk40 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1120 nhr-17(gk509) X. C. elegans C02B4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1121 mlh-1(gk516) III. C. elegans T28A8.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1122 nhr-120(gk519) X. C. elegans C25B8.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1123 F55C12.1(gk515)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F55C12.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk515 homozygotes (late larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1124 ags-3&F32A6.2(gk517) X. C. elegans F32A6.4, F32A6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1125 rig-6(ok1589) II. C. elegans C33F10.5. Superficially wild type. External left primer: GAGCCGTTTTAACCCAATCA. External right primer: TAATTTTCAGAACCGTCGGG. Internal left primer: ACGTTCTGCTGCTCTCCATT. Internal right primer: GCAACCAACTCCTTCCATTC. Internal WT amplicon: 3304 bp. Deletion size: 1554 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1126 C50F4.16(gk518) V. C. elegans C50F4.16. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1127 nhr-126(gk520) V. C. elegans F44C8.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1128 mis-12&Y47G6A.25(ok1536)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans Y47G6A.24, Y47G6A.25. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1536 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1129 noah-1(ok1587)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans C34G6.6. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1587 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAGCAGATGAATCGAAACGG. External right primer: CTCGAGACAAGCCAATGTCA. Internal left primer: TCTTCACAGCCGATGACTTG. Internal right primer: CAATGAAGGTCTTTGCGGTT. Internal WT amplicon: 3308 bp. Deletion size: 2455 bp. Deletion left flank: TCACAGCCGATGACTTGATTTCAATAGCTC. Deletion right flank: TGAGAGTATACAATTTTGAAATATATTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC113 cln-3.2(gk41) I. C. elegans C01G8.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1130 ZK328.7(gk508) III. C. elegans ZK328.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1131 rnp-1(ok1549) V/nT1 [qIs51] (IV;V). C. elegans ZK863.7. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1549 homozygotes (sterile Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1132 C50F4.16(gk531) V. C. elegans C50F4.16. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1134 C02B4(gk534) X. C. elegans C02B4. Superficially wild type. External left primer: TGTGTGTGTCGAACGTGAAA. External right primer: TCCGATAAAATCTGCTCGCT. Internal left primer: CAGTTTCCCAGCTTTCTTCG. Internal right primer: TGCTCATTGATGTTTGAGGG. Internal WT amplicon: 1884 bp. Deletion size: 657 bp. Deletion left flank: CTAGAACCTACAATCACAAAATAATGCACC. Deletion right flank: ATATATTTATGTTTCAAAGTGTTATGCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1135 R166.3(gk541)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans R166.3. Homozygous marginally-viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk541 homozygotes (mostly sterile; some animals bear a few progeny, but a population may be difficult to maintain). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAGGAGTACACGCCGGATAA. External right primer: AGACCATTTTGCAGGATTGC. Internal left primer: AAGTGCTGACCGAAGAGCAT. Internal right primer: TGGGATTTGAAACGAGAACC. Internal WT amplicon: 1529 bp. Deletion size: 388 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1137 hda-1(ok1595) V/nT1 [qIs51] (IV;V). C. elegans C53A5.3. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1595 homozygotes (mid-larval arrest). Occasional non-GFP segregants grow up and reproduce, but it has not been determined whether these are true homozygotes or a rare recombinant class. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1138 drsh-1(ok369) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F26E4.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok369 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGTCTCGAAGTTCTTGCCT. External right primer: AAACGAAGAACGAGCTGGAA. Internal left primer: TCAGGAACCATCGTGTGAAA. Internal right primer: CTTGCATGCCATCATATTCG. Internal WT amplicon: 2395 bp. Deletion size: 1742 bp. Deletion left flank: CTAGATTAGCCAAAGCCAGCTCAGCCACCC. Deletion right flank: TATCGTTGAATTTATATTCGATGACTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1139 mom-4(gk563) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F52F12.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk563 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTGAACTTGGCTGTTGGA. External right primer: CGCAGATGTATGGTTTGGTG. Internal left primer: TTGAAACATCCATGAAGCCA. Internal right primer: CACTGATGAACAGCAAACGG. Internal WT amplicon: 2042 bp. Deletion size: 632 bp. Deletion left flank: AAGAATATTTGATTGCTGCTGGCCTGAAAA. Deletion right flank: AGACCAACGGGACACAGACAGATTTCCGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC114 T19E10.1a(gk44)/mIn1 [dpy-10(e128) mIs14] II. C. elegans T19E10.1a. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk44 homozygotes (sterile). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1140 nhr-132(gk523) V. C. elegans R11G11.1. Mildly Him. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1141 trp-4(ok1605) I. C. elegans Y71A12B.4. Superficially wild type. External left primer: AAGACTCCGGTACACGTTGC. External right primer: AGAAGCATCCGCACAAGACT. Internal left primer: AAGTTTGGTGGCTCAATTCG. Internal right primer: CTTTGAGCGGCTAAATGGAG. Internal WT amplicon: 3332 bp. Deletion size: 1027 bp. Deletion left flank: GGCCGAGGTTACTGGACCAGGACCAGGGCC. Deletion right flank: TTTTACCGATTTTTAGGCAGAATTGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1142 tag-344(gk524) I. C. elegans B0511.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1144 +/szT1 [lon-2(e678)] I; cas-1(ok1523)/szT1 X. C. elegans F41G4.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1523 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1145 pps-1(ok1625) IV/nT1 [qIs51] (IV;V). C. elegans T14G10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1625 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTCTCAGAAACCCACGCAT. External right primer: TCTCCACGAGGTTTACCACC. Internal left primer: ACGGGATGAAAACAACGAAG. Internal right primer: AAACGCGTGTCAATATGGGT. Internal WT amplicon: 2542 bp. Deletion size: 1092 bp. Deletion left flank: TGAACGTGTATGTCGTCAATTTGGAACAAA. Deletion right flank: AGAATAAGGAAAATATCAAGAAAATATGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1146 csn-6(ok1604) IV/nT1 [qIs51] (IV;V). C. elegans Y67H2A.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1604 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1147 far-3&far-4(ok313) V/nT1 [qIs51] (IV;V). C. elegans F15B9.1, F15B9.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok313 homozygotes (mid- to late larval arrest, may develop to adulthood and lay eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1148 vha-5(ok1588) IV/nT1 [qIs51] (IV;V). C. elegans F35H10.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1588 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1149 C25B8.4&kqt-1(ok413) X. C. elegans C25B8.1, C25B8.4. Superficially wild type. External left primer: CAAGCAGCTCCAAGTGATGA. External right primer: CCCGCTAGTGCTACTCCATC. Internal left primer: GAAACATCCCTTTCAACCCA. Internal right primer: TTATGGTGTCGTGCACTCGT. Internal WT amplicon: 2570 bp. Deletion size: 547 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC115 +/szT1 [lon-2(e678)] I; tth-1(gk43)/szT1 X. C. elegans F08F1.8. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous gk43 hermaphrodites (arrested Dpys). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1150 nhr-151(gk536) V. C. elegans C06B8.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1151 prdx-3(gk529) III. C. elegans R07E5.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1153 +/mT1 II; him-10(ok263)/mT1 [dpy-10(e128)] III. C. elegans R12B2.4. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok263 homozygotes (sterile Unc). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1154 C42C1.11&C42C1.12(ok348) IV/nT1 [qIs51] (IV;V). C. elegans C42C1.11, C42C1.12. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok348 homozygotes (early to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1155 +/szT1 [lon-2(e678)] I; F19H6.1(gk506)/szT1 X. C. elegans F19H6.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk506 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGAAAAGAATCGGCCTAGC. External right primer: CACGCAAACGAGAACACAGT. Internal left primer: GGGCTAAGGCTCTCGCTAAT. Internal right primer: CAAATGCATCCAGTAGGCAA. Internal WT amplicon: 1675 bp. Deletion size: 340 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1156 F30A10.6(ok1602) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F30A10.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1602 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTAATGGCTCCTTGCTCAGG. External right primer: CCGAACCGCAAGTTGTTTAT. Internal left primer: GTCACAGCTAATGGGAGCGT. Internal right primer: AACTCAACAGGATCCCTCCA. Internal WT amplicon: 3044 bp. Deletion size: 745 bp. Deletion left flank: CTTGTAAATCAAAAAGGAAGAGAGAAAAAA. Deletion right flank: CTACGGAAAACACTTTTTTACTACCTTATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1157 C30C11.4(gk533) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C30C11.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk533 homozygotes (sickly sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1158 T07F8.4(gk530)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans T07F8.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk530 homozygotes (sterile adult, lays no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCACTTGGCTGATTCGTCTG. External right primer: TGTGCAAATGGATCAGGTGT. Internal left primer: CCTTCAACCGTTGCTTCATT. Internal right primer: ACAGAACGATCGGGAAGTTG. Internal WT amplicon: 1857 bp. Deletion size: 974 bp. Deletion left flank: GGTTCTGCAGCAGCCGAACTTGATTCCCCT. Deletion right flank: TTACTGAGCAAACGCTTTAGTGTTAGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1159 Y75B8A.29(gk535) III. C. elegans Y75B8A.29. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC116 inx-8(gk42) IV. C. elegans ZK792.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1160 egl-30&emr-1(ok252) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans M01D7.7, M01D7.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok252 homozygotes (phenotype uncharacterized). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1161 M04F3.1(ok1627) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans M04F3.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1627 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGAAGAATTTGGAGGATGA. External right primer: GGCTACGAGCAGTTCCTGAC. Internal left primer: GCGTATTGTAAGGCACGGTT. Internal right primer: AATGTGATTTGCCGTTCCTC. Internal WT amplicon: 2153 bp. Deletion size: 917 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1162 +/mT1 II; spe-41(ok1590)/mT1 [dpy-10(e128)] III. C. elegans K01A11.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1590 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACTATCCCCACAGAAGCC. External right primer: ATACCTACGCCCGCCTACTT. Internal left primer: GCGCGTAAACTTCTTTCCAG. Internal right primer: TCTCCACATTTTCCACCACA. Internal WT amplicon: 3007 bp. Deletion size: 1099 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1163 T27A1.4(gk532) II. C. elegans T27A1.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1164 ZK328.7(gk477) III. C. elegans ZK328.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1165 let-19&sgn-1(ok331)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F07H5.2, K08F8.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok331 homozygotes (grotty sterile Dpy with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGAAAATTGGGAGTTCGGAG. External right primer: ACCACTTGTTCCTTGCCAAC. Internal left primer: GGACTGGAAACTCCAAGCAG. Internal right primer: GACTGATGAGCCGGTATGGT. Internal WT amplicon: 2637 bp. Deletion size: 1456 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1166 +/mT1 II; brc-2(ok1629)/mT1 [dpy-10(e128)] III. C. elegans T07E3.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1629 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CATGGAAACAACAGAAGGGG. External right primer: GAGCCATTTTGAAGTTTGGC. Internal left primer: CGGCGTTTCTTCTTGTCTTC. Internal right primer: AAAATCAGGTTTTCATGGCG. Internal WT amplicon: 3006 bp. Deletion size: 809 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1167 sulp-6(ok1586) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans W01B11.2. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1586 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGTTGGAACAGTTGTGGAA. External right primer: TTCATGTCTATTCGCCCACA. Internal left primer: TGGCTCAACAAATGGAACAA. Internal right primer: TTCGGTATTTCCGCATCTTC. Internal WT amplicon: 3052 bp. Deletion size: 1653 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1168 bbs-2(gk544) IV. C. elegans F20D12.3. Superficially wild type. External left primer: ATGGTCCGTGAATCCAATGT. External right primer: CTTCAAAAAGTCCCTCTGCG. Internal left primer: CCATGGCAACATGTAAGCAC. Internal right primer: TTATGTGAGGCTTCGACACG. Internal WT amplicon: 1741 bp. Deletion size: 712 bp. Deletion left flank: GATAATGTCGAACTTGCAAATGTATTTTCG. Deletion right flank: TTAAAAGAAAGACAATGGAGAATCAAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC117 vab-10(gk45) I. C. elegans ZK1151.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1172 nhr-129&nhr-168(gk538) V. C. elegans C50B6.14, C50B6.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1175 +/mT1 II; F37C12.13(ok1635)/mT1 [dpy-10(e128)] III. C. elegans F37C12.13. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1635 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1176 +/szT1 [lon-2(e678)] I; F53B3.1(ok1636)/szT1 X. C. elegans F53B3.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1636 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1179 F08B12.1(gk545) X. C. elegans F08B12.1. External left primer: CTCCTCCTACACCCTCTCCC. External right primer: CGCTAAGCTTGTGTTGGTCA. Internal left primer: GAAGCCGCTAGAAGAACGTG. Internal right primer: ATTTAGGTACGCGCGAGAAA. Internal WT amplicon: 2016 bp. Deletion size: 569 bp. Deletion left flank: CCTTATAAATCCGCGGAGCAATACAAATGT. Deletion right flank: ATCTTCGCAAATCAACTCAGCAAACACTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC118 haf-7(gk46) V. C. elegans Y50E8A.16. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1180 gex-2(ok1603)/dpy-9(e12) IV. C. elegans F56A11.1. Homozygous lethal deletion chromosome balanced by morphological marker. Heterozygotes are WT, and segregate WT, Dpy (dpy-9 homozygotes), and ok1603 homozygotes (probably sterile adult with protruding or ruptured vulva). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTCACCCTCTCTCCCACCT. External right primer: AAGCAGTGGGTTGAAAAACG. Internal left primer: CAGCTGAAAAATGAACGCAA. Internal right primer: GTGTTGGCCGCTGTATCTTT. Internal WT amplicon: 2748 bp. Deletion size: 1903 bp. Deletion left flank: AAACATACCAGATGTTTTGCAGCTTCTCGA. Deletion right flank: GCAAATTTGGCAAATTTGCCGAGCTCGGCA. Insertion Sequence: ATTTGGCAAATTTGGCAAATTTGCCGGCAAATTTGGCAAATTTGCCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1181 mau-8(ok1592) IV/nT1 [qIs51] (IV;V). C. elegans Y62E10A.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1592 homozygotes (thin twitcher, late larval or sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTTCCGGGTTTTACTGGA. External right primer: AGGAGAATGGGAGGCTCTTC. Internal left primer: GCGGGTTACTGTAGCAGCTC. Internal right primer: TCACTTGCATATCCACCAGC. Internal WT amplicon: 2234 bp. Deletion size: 593 bp. Deletion left flank: CCTTTTTTGATTTTTTAGAAAAAAACTTTT. Deletion right flank: TGTGAATATTTGACACGAATCGTTAAGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1182 C07E3.5(gk550) II. C. elegans C07E3.5. External left primer: GTCGTCGTTTTTGTTGCTGA. External right primer: ATTTCCTGCAAAACATTGCC. Internal left primer: CCGAATTTGAATTACCGCAT. Internal right primer: GCCAGAAGCTTCCAGTTCAA. Internal WT amplicon: 1894 bp. Deletion size: 873 bp. Deletion left flank: CCTCTGGTAATTCTTCACCCATCTGAAGTC. Deletion right flank: AGATATTAATTTTTAAAATATGAAAACTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1183 sma-9(ok1628) X. C. elegans T05A10.1. External left primer: AACCATCATGAAAGGCCAAG. External right primer: TTGTTGCGACAGATACGGAG. Internal left primer: CCAGGGAACAATCAGCAAGT. Internal right primer: TGCTCCTGACCAAACTTGAA. Internal WT amplicon: 2299 bp. Deletion size: 1100 bp. Deletion left flank: AGCTGGAATGACTTCAAGAACTCATCGTAC. Deletion right flank: GTGGTCGTGGGCGTGGAAGATATATTTGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1184 T24H10.7(gk551) II. C. elegans T24H10.7. External left primer: GATCGAGGAAATTCGGCATA. External right primer: CGTCACCATGTGAGGAAATG. Internal left primer: CATGCGCATTCCTTCTATCA. Internal right primer: TCAAACCATAACGGCATTCA. Internal WT amplicon: 2262 bp. Deletion size: 1430 bp. Deletion left flank: GGAGAGAGGCTTAGACATTTACACATGTGA. Deletion right flank: CAGGGTAGATTGTATTGTTTCGTTTTTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1185 tag-72(ok534)/hT2 I; hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C25A1.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok534 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1186 haf-3(gk549) V. C. elegans F57A10.3. Superficially wild type. External left primer: AACCGGTTCTTGTCCAACTG. External right primer: CTACACCTCCCTGGCAATGT. Internal left primer: ACGACGCCAATATGATGGAT. Internal right primer: GAACGTCTTTCTTCCGTTCG. Internal WT amplicon: 1973 bp. Deletion size: 1141 bp. Deletion left flank: TTTTTTAATAAGTTTAATCACATTTTTCGG. Deletion right flank: GTAATTTCTCTTTTTTTTTAAAAAGACTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1187 C30F8.3&Y110A7A.20(gk548) I. C. elegans Y110A7A.20, C30F8.3. External left primer: CTCCAAGTTCTGCATCGTCA. External right primer: ATCCCGTTCCTGTGTGTTTC. Internal left primer: GGTAACGCCACGAAGACATT. Internal right primer: TCCGTTTCAACAACATTTGC. Internal WT amplicon: 1843 bp. Deletion size: 878 bp. Deletion left flank: GAACCCTTGTGTTTTGGGCTGGCACGATGT. Deletion right flank: CTTAGGCTTATTGATCCAGGTAGATTTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1188 T06G6.3(gk546) I. C. elegans T06G6.3. Superficially wild type. External left primer: GTAGGCGCTAAAACGACTGG. External right primer: AAATATTTTCCCGCCATTCC. Internal left primer: GAAATAAGGCGAGATGCAGG. Internal right primer: AGGCAAAGTCGAAGGTGAAA. Internal WT amplicon: 1775 bp. Deletion size: 808 bp. Deletion left flank: ACTAACCGGGGATTTTCGCTTCTCCGCGGC. Deletion right flank: AATTTTTGTTTATTTCAGAAGTAACATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1189 F53H10.2(gk547) V. C. elegans F53H10.2. External left primer: GCACTTTCTAGGCGGAACTG. External right primer: GTGTATGAATGGTCGGGGTC. Internal left primer: CTGAAGTGGTGGAGGTGTCA. Internal right primer: TCCTGTTGTTGGTTGAGTCG. Internal WT amplicon: 1685 bp. Deletion size: 1280 bp. Deletion left flank: TATTTTATAGGAAACACTATGTTTATTAAT. Deletion right flank: TAAGTTCAGTGTGGCAGAGTAGTCTCCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC119 ptb-1(gk113) II. C. elegans D2089.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1190 ceh-27(ok1655) V/nT1 [qIs51] (IV;V). C. elegans F46F3.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1655 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGAGGATAGTTTGCAGGAG. External right primer: CTCTTCCCCTCCGATACCTC. Internal left primer: AGCTGCAGTCAGAAGTGGGT. Internal right primer: AATCCCAGTTTCTCGCCTTT. Internal WT amplicon: 2753 bp. Deletion size: 1273 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1191 pab-1(ok1656) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y106G6H.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1656 homozygotes (probable early larvarl arrest ). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTTTGCGATTCATTTCA. External right primer: CTAGACGTCGCCTGACTTCC. Internal left primer: GTTCAACATGTGTTGGTCCG. Internal right primer: GACCCAACTCCTCACCCATA. Internal WT amplicon: 2732 bp. Deletion size: 1938 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1192 unc-89(ok1659) I. C. elegans C09D1.1. Superficially wild type. External left primer: TCAAGTTCTTTTCGGGTTGG. External right primer: AGCGAAAGAGCAGCATGATT. Internal left primer: TCAAACAGCGCATGAAAAAC. Internal right primer: TACCCAAAAACGGAAAATCG. Internal WT amplicon: 2637 bp. Deletion size: 923 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1193 C34D1.2(gk552) V. C. elegans C34D1.2. Superficially wild type. External left primer: GCGTATGCTCACTTGCTTCA. External right primer: TGGAAACCAGCACAACAAAA. Internal left primer: TTTGATTGTATGTGTCCCGC. Internal right primer: CAATTTGGAAGCTGGGAAAG. Internal WT amplicon: 2086 bp. Deletion size: 1543 bp. Deletion left flank: AAAATATATAAGGAAAGTACAATTAAATAA. Deletion right flank: TGTTGTTGTGTGTACCTGAGTATAAGCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1194 nhr-158(gk553) V. C. elegans C17E7.6. Superficially wild type. External left primer: CCCGCATCTCTTTTGGATAA. External right primer: GCCAGTCGGAAATAACCAGA. Internal left primer: TTTGTCCAAATATGTCCGCA. Internal right primer: AGCCCTGTTTCTATCGCAGA. Internal WT amplicon: 1728 bp. Deletion size: 1091 bp. Deletion left flank: CCAAATTCAACAAAAGATCGACAGTGGTGT. Deletion right flank: ACACACTTCCTCTGCGGTATATCGATTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1196 K02F3.10&rnp-5(ok1634)/sC1 [dpy-1(s2170)] III. C. elegans K02F3.11, K02F3.10. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1634 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTGTCCAAAAAGTGCCTCC. External right primer: AGGCGCTCTTGATTCACAGT. Internal left primer: TATCGGATAACAAAAGGCGG. Internal right primer: AGCAGCTCGTCCAGTAGCTC. Internal WT amplicon: 2252 bp. Deletion size: 1401 bp. Deletion left flank: GTTCCTGAAACAAAAATCGGTGATAAAAAT. Deletion right flank: CGATTTGTCCTCCATCCATGTGCTTGATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1197 dao-3(ok1678) X. C. elegans K07E3.3. Superficially wild type. External left primer: GCTCACGCTCAAAACATGAA. External right primer: TCTTCTCATCACTCCCCCAC. Internal left primer: TGATTTGTTCGATGTTGCGT. Internal right primer: TTTTTCACTCTGTCCCCCAC. Internal WT amplicon: 2639 bp. Deletion size: 1500 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1198 Y39G8B.1(ok1682) II. C. elegans Y39G8B.1. Superficially wild type. External left primer: TAGGCAAACCGGCAATTAAC. External right primer: TGGCCCATTATTTCTCATCC. Internal left primer: CCCATCAATTGCCTGAATCT. Internal right primer: GCCCCCAAGTTCAATATCAA. Internal WT amplicon: 2251 bp. Deletion size: 892 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1199 T26C11.4(ok1680) X. C. elegans T26C11.4. Superficially wild type. External left primer: CCAGACATTTGTCGCAGAGA. External right primer: AATTCAAAGTTCCGCCAAGA. Internal left primer: AGTATTGGCACGGACGAATC. Internal right primer: CAGATGGACATCAGCCATTG. Internal WT amplicon: 3154 bp. Deletion size: 685 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC12 C11D2.6(gk9) IV. C. elegans C11D2.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1200 jun-1(gk557) II. C. elegans T24H10.7. Superficially wild type. External left primer: GATCGAGGAAATTCGGCATA. External right primer: CGTCACCATGTGAGGAAATG. Internal left primer: CATGCGCATTCCTTCTATCA. Internal right primer: TCAAACCATAACGGCATTCA. Internal WT amplicon: 2262 bp. Deletion size: 1168 bp. Deletion left flank: CATTAGCCGACGATTTTTGTGACTAACTGC. Deletion right flank: ATTTTTTTAGCATTCAATTCAAATTCAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1201 unc-89(ok1658) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C09D1.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1658 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCAAGTTCTTTTCGGGTTGG. External right primer: AGCGAAAGAGCAGCATGATT. Internal left primer: TCAAACAGCGCATGAAAAAC. Internal right primer: TACCCAAAAACGGAAAATCG. Internal WT amplicon: 2637 bp. Deletion size: 1274 bp. Deletion left flank: TCCTATCATCTATTTCATTCGATCAAACAA. Deletion right flank: ATTTTGGGGGGGGGGGGGGGCAGAAATCGG. Breakpoints should be confirmed; deletion may also involve insertion and/or rearrangement of sequence between external left and internal left primers. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1203 +/mT1 II; apc-2(ok1657)/mT1 [dpy-10(e128)] III. C. elegans K06H7.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1657 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACGCAAAATACGCAAAAA. External right primer: GGAAGTGCTGATTTGGCAGT. Internal left primer: ATGACGACAGTTCTGCAACG. Internal right primer: GGCTGACGATCTCTTGGAAA. Internal WT amplicon: 3306 bp. Deletion size: 650 bp. Deletion left flank: CCTAAATTATATATAACATTTTCAGAAAAA. Deletion right flank: GACCTGACACTGTACAACAAATTATCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1204 nhr-34(gk556) IV. C. elegans F58G6.5. External left primer: CACCATCACATCCAGCTTTG. External right primer: TCGATTTTGTATTCCCTCGC. Internal left primer: TCGGCACCAAGCAATATGTA. Internal right primer: AAGCTTCTTGCGCTTTGAAC. Internal WT amplicon: 1669 bp. Deletion size: 1067 bp. Deletion left flank: ACATCAACTCTGCACAATTGATCGAATTCC. Deletion right flank: TACTATCTCAGATAATTTCTCTGTAACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1205 nhr-163&nhr-139&nhr-140(gk566) V. C. elegans C33G8.12, C33G8.8, C33G8.9. Superficially wild type. External left primer: TAAAACGCTCGCCAAAATCT. External right primer: AAATTTGCGACAGTTGACCC. Internal left primer: CCATCTGCAGAGAAAGGCTC. Internal right primer: AGCTGCAAAGCTGTGTCGTA. Internal WT amplicon: 2376 bp. Deletion size: 2236 bp. Deletion left flank: GGCTGGTTAATATATAATAAAAAATCATTC. Deletion right flank: GTTACGACACAGCTTTGCAGCTTCTTCACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1206 nhr-139(gk559) V. C. elegans C33G8.8. Superficially wild type. External left primer: TAAAACGCTCGCCAAAATCT. External right primer: AAATTTGCGACAGTTGACCC. Internal left primer: CCATCTGCAGAGAAAGGCTC. Internal right primer: AGCTGCAAAGCTGTGTCGTA. Internal WT amplicon: 2376 bp. Deletion size: 1714 bp. Deletion left flank: AGGGTCATTTGGAACCCCAAATAATCATTT. Deletion right flank: AAACCCCGTATGATGAAAAAAAAATCAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1207 nhr-280(gk558) III. C. elegans C29F9.13. Superficially wild type. External left primer: GGCATTAGCCGAACAAACAT. External right primer: TATAATACGCGGGTTGCCTC. Internal left primer: TCTTGAGTTGTTCGTGGCTG. Internal right primer: ACCGACTGACCAAACCAAAC. Internal WT amplicon: 1767 bp. Deletion size: 1249 bp. Deletion left flank: AGCACGGATTTTCTGCTAATTAGCAATGGT. Deletion right flank: GCCTTTTCTCGCCTTCGTGGATGACCTACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1208 C17G1.4(ok1679) X. C. elegans C17G1.4. Superficially wild type. External left primer: AACGTGTGAGTTCAGTGGGA. External right primer: TGCTTCAGAATTAATGGGGC. Internal left primer: GATTTTCACGCATGTTGCAG. Internal right primer: AATTAATTGGGCGCTTGATG. Internal WT amplicon: 3026 bp. Deletion size: 973 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1209 F35G2.1(ok1669) IV. C. elegans F35G2.1. Superficially wild type. External left primer: GCGCTTTTCTTGTCGAGTTC. External right primer: GAACGAGCTAGGATTGCAGG. Internal left primer: GGTCCGTGATTGGTATCCAG. Internal right primer: GTTCGTTCAGAAGGCGAGAC. Internal WT amplicon: 3267 bp. Deletion size: 1711 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1210 C11E4.4(ok1701) X. C. elegans C11E4.4. Superficially wild type. External left primer: AGTTGGTCGTTAGGTGACCG. External right primer: GTGTGACCTCCGAAGACCTC. Internal left primer: TTTTGGACCATTGTGGTTGA. Internal right primer: ACGCTCGTTCCTCTCAAGAA. Internal WT amplicon: 2244 bp. Deletion size: 1158 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1212 Y73B6BL.21(gk554) IV. C. elegans Y73B6BL.21. Superficially wild type. External left primer: TTACCCCGATGACTCACTCC. External right primer: AACCAAGCGGAACATTTTTG. Internal left primer: GCAAGTTGGCTCAAATCTCC. Internal right primer: CACTGGTGGCTCATCTTTCA. Internal WT amplicon: 1651 bp. Deletion size: 1261 bp. Deletion left flank: TTAGCGGGCTGCATTGGTTTTATACACATA. Deletion right flank: ATCTTCATAAATTTTCACAATTTATGCACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1213 gei-8(ok1671) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C14B9.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1671 homozygotes (mid-larval arrest, Dpy). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAGTGCTGGATACTGCAAA. External right primer: GACAAGTTGGTTGGACGGAT. Internal left primer: GGTTTACCCTGTTGCGAAAA. Internal right primer: CATCACCGACACTTGATTGG. Internal WT amplicon: 3299 bp. Deletion size: 1095 bp. Deletion left flank: AGCTTGTGGAAACTGAGGAAATTGATATTT. Deletion right flank: TGTGCCTGTGGCTGCTGCTGCTGTTGTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1215 rga-2(ok1683) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y53C10A.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1683 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGCATTTTAGCTGTGGCTG. External right primer: TCCAATGAGCTTTTTCGGAC. Internal left primer: TGTGGCTGCTCATCTTGTTC. Internal right primer: CCTATGCTGAGCCTCTGTCC. Internal WT amplicon: 3209 bp. Deletion size: 930 bp. Deletion left flank: CGGCAAATCTAACTATTTATAAGTGTAAGA. Deletion right flank: GCTCCAAAATGAATGCTTCATCCTTATCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1217 egl-27(ok1670) II. C. elegans C04A2.3. External left primer: TCGAGTTGGGCTCAGTCTTT. External right primer: CAGCGATGATGATGAAGGAA. Internal left primer: GGTAAAAGCTGCCAATCCAA. Internal right primer: CTTGTCCTCACTCCGCTCTC. Internal WT amplicon: 2523 bp. Deletion size: 1747 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1218 ins-18(ok1672) I. C. elegans T28B8.2. Superficially wild type. External left primer: TTCAGATTGCTCGAAAGGCT. External right primer: GCCATTGTATCCATCCCATC. Internal left primer: CGTCGCCACTATTCCAAAAT. Internal right primer: CGTATTTTGTGGGCGGTACT. Internal WT amplicon: 2143 bp. Deletion size: 940 bp. Deletion left flank: AAGCTGGTTTGTTTTCATGTTTGTAATACA. Deletion right flank: TTTGGCAATTGGCAATTATTTAATTCTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1219 F34D6.4(ok1691) II. C. elegans F34D6.4. Superficially wild type. External left primer: CTACTGCCAGAGAAGGCGAC. External right primer: AACCCTAACGTATCCCCACC. Internal left primer: TACATTCCGACGACTTGCAG. Internal right primer: CCCACAGTAACCCCACAGTC. Internal WT amplicon: 3166 bp. Deletion size: 1731 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1220 hlh-25(ok1710) II. C. elegans C17C3.7. Superficially wild type. External left primer: TTTCCATCTCAGCGTGTGAC. External right primer: ACATCCTGTCCCAGCTTCAC. Internal left primer: AGCAAACCGGAGTTCTCAAA. Internal right primer: AGAATGGGACATCCCACAAA. Internal WT amplicon: 2113 bp. Deletion size: 1550 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1221 ifa-4(ok1717) X. C. elegans K05B2.3. Superficially wild type. External left primer: ATGTTTCACTTTGGCGGTTC. External right primer: AGAGCGAATACCGAAGCTCA. Internal left primer: CGAGAGTAATTCCGGGTTCA. Internal right primer: TCGCAAGATGGAGAAGGACT. Internal WT amplicon: 2608 bp. Deletion size: 894 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1222 mbf-1(gk562) IV. C. elegans H21P03.1. Superficially wild type. External left primer: CAGGCATCATCCAATGACAG. External right primer: TGCACTTTTCTCCTCTCGGT. Internal left primer: TGCATATCCCAACATTCCAA. Internal right primer: TCTTTGCTAACCGGCTGTCT. Internal WT amplicon: 1923 bp. Deletion size: 1428 bp. Deletion left flank: AATCATGTCACAGTCATGGATTTAAAATGA. Deletion right flank: ACCAGAAAACTCTATTCCAATATAGCAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1224 polg-1(ok1548)/mT1 II; +/mT1 [dpy-10(e128)] II. C. elegans Y57A10A.15. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1548 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Outer Left Sequence: ACCGTAGCCCTTTCCTCATC. Outer Right Sequence: CGCATTTCCCATCTGTCTTT. Inner Left Sequence: ACCTCTTCGTTTTGGGGATT. Inner Right Sequence: CCATCCGGCCTATTTAATCA. Inner Primer WT PCR Product: 3241. Deletion size: 2149 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1226 C34D1.2(ok1712) V/nT1 [qIs51] (IV;V). C. elegans C34D1.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1712 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTAAAAGCGTTTCAGGCGA. External right primer: CATGCGAGAGTACTGGACGA. Internal left primer: AATTACTTGGCTGGCGAAAA. Internal right primer: TGGAACCACTGGAAATGACA. Internal WT amplicon: 2173 bp. Deletion size: 1133 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1229 K08F11.3(ok1715) IV/nT1 [qIs51] (IV;V). C. elegans K08F11.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1715 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTCATGGACGTTGTTGTGC. External right primer: GCATTTCTCCTTTTTGCTCG. Internal left primer: TTTGCTTCAGATTTGCGATG. Internal right primer: TTTCAGATGGCTGACACTCG. Internal WT amplicon: 3347 bp. Deletion size: 773 bp. Deletion left flank: GCAGCCTGATCAACTCTCTGATCAACAAGA. Deletion right flank: GTTTCCACATGATATATTCAATTTTTTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1230 C44H9.4(ok1688) V. C. elegans C44H9.4. Superficially wild type. External left primer: GAACAGAATGCGTTCAGCAA. External right primer: AAATCAAAAGACCGGTTTCG. Internal left primer: CTCCAAAACCCCGTCAAGTA. Internal right primer: TTCGGTGTCCTCTTTGGTTT. Internal WT amplicon: 3088 bp. Deletion size: 737 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1232 nhr-122(gk560) IV. C. elegans Y41D4B.9. External left primer: AACGAGGTCTCGACTGTGCT. External right primer: CTTTTCCTTTTCTACCCCCG. Internal left primer: ATTCGGAAAGAATTTGCACG. Internal right primer: TTTCAGTCTGGGATGGGTTT. Internal WT amplicon: 2011 bp. Deletion size: 1537 bp. Deletion left flank: AGAATATTGTTTGTCTGTCCGTTTTTTTTT. Deletion right flank: AGCTGCTCTAAAATCTCCTTGCAGAAAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1233 ocr-2(ok1711) IV. C. elegans T09A12.3. Superficially wild type. External left primer: TAGCATTTGTAAAACCCGGC. External right primer: AAAAACCCCCAATTTTCCTG. Internal left primer: CGAAAGCTTCAATGGGTGAT. Internal right primer: GGCTCCGAAAGCTTACCTCT. Internal WT amplicon: 2957 bp. Deletion size: 1512 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1234 oig-1(ok1687) III. C. elegans C09E7.3. Superficially wild type. External left primer: ATTCAAATTCGCGCGTAAAC. External right primer: TCAGAGCTCGCAGAACAAGA. Internal left primer: GATCCGAAACATGGTCGTTT. Internal right primer: CTTGTGCTTCCGGATTTAGG. Internal WT amplicon: 2237 bp. Deletion size: 1395 bp. Deletion left flank: TCTAGGCTTTCGATTTTTATTTCAGAAGTG. Deletion right flank: GTTTTTTTGTCCCCATATCAGTTCTGTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1237 C18D11(ok1722) III. C. elegans C18D11. Superficially wild type. External left primer: GTCGTCAGCTGATTCGTCAA. External right primer: GCGTGTTAGAAACGTGCAAA. Internal left primer: ACCGTATCCCCGGTTTTTAG. Internal right primer: TGCGATCTGCTATTGCTACG. Internal WT amplicon: 2922 bp. Deletion size: 773 bp. Deletion left flank: TACGGGTTGATCTACAAAAAACGCGGGAAT. Deletion right flank: GGTTTTTCAACTTTCTTCAAAAAAAATTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1238 Y66D12A.12(gk561) III. C. elegans Y66D12A.12. External left primer: TGGCAATCTGTTTGCTCTTG. External right primer: TAGTGGAGAGGCGCTGAAAT. Internal left primer: TCTCACACAGTGAAGCACCC. Internal right primer: AGTTGAGAACTCTGCCGCAT. Internal WT amplicon: 1862 bp. Deletion size: 1352 bp. Deletion left flank: TGCCGGGGATTAGCAGGGTGGTCCAGACGA. Deletion right flank: CTCGTGTGCCAAAAGTCCTATGAGCATTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1240 mstr-1(ok1685) I. C. elegans F22D6.2. Superficially wild type. External left primer: ACTCTCCTCCCCGTCATCTT. External right primer: CCACATGAGTGGGTGTCTTG. Internal left primer: ATCAACTGATCGCCAGGAAC. Internal right primer: CTTGTGACCTGCCTCTCCTC. Internal WT amplicon: 2103 bp. Deletion size: 1041 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1241 skr-1(ok1696) I. C. elegans F46A9.5. Superficially wild type. External left primer: AATCCGTAAGGAAAACGCCT. External right primer: AGTGTTTTCGGAAATGGCAC. Internal left primer: CACTGCCAGCTGACACAACT. Internal right primer: CGCAGAATTTGAACACGTTG. Internal WT amplicon: 2194 bp. Deletion size: 1740 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1242 +/mT1 II; cup-5(ok1698)/mT1 [dpy-10(e128)] III. C. elegans R13A5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCAGCCCGAAATTTTTGTAA. External right primer: CCGTAATATGTGTTGCAGCG. Internal left primer: CGTGTCTCTAGCTTCCCTGC. Internal right primer: ATCTACGTGCATTCGCACTG. Internal WT amplicon: 2867 bp. Deletion size: 1546 bp. Deletion left flank: TGCTTCTTCAAATGCTTCTCGAAGGCCAAC. Deletion right flank: ATTGTGGTCAACGATGCGCTTATTATCATT. Insertion Sequence: GTGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1243 T14B1.1(ok1702) X. C. elegans T14B1.1. Superficially wild type. External left primer: TTTGGGGACATACAAGAGGG. External right primer: TCTCGCAAATAAGGCCATTC. Internal left primer: AGGAGAGGGGAGAAATGGTG. Internal right primer: TGTAATCTTTACCCGCCCAC. Internal WT amplicon: 2121 bp. Deletion size: 1117 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1245 smc-3(ok1703) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y47D3A.26. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1703 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1246 +/szT1 [lon-2(e678)] I; apl-1(ok1697)/szT1 X. C. elegans C42D8.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1697 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGTGATCGGTGCTTCTGAAT. External right primer: AAGTTCATTCCAATGGTCGC. Internal left primer: AGCTACGGGGAGAATTGGTT. Internal right primer: GCCGCAAGGTATTGTTTTGT. Internal WT amplicon: 3311 bp. Deletion size: 2848 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1247 taf-10&K03B4.2(ok1719) V/nT1 [qIs51] (IV;V). C. elegans K03B4.3, K03B4.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1719 homozygotes (scrawny sterile adult with glassy appearance). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGCAAATTGTGGTTTTTCT. External right primer: GAAAAGTGTGGAACAGGGGA. Internal left primer: CTATTTTCGGGATTTTGGCA. Internal right primer: AACCTCTTGGCCTCCGTAGT. Internal WT amplicon: 2562 bp. Deletion size: 1311 bp. Deletion left flank: CGAAAACGCGCGCCGCACATTGCAAGTGGG. Deletion right flank: ATCGCAACCGTCCCCCGTTCCAAGTGTGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1248 gmn-1&Y75B8A.18(ok1708) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y75B8A.17, Y75B8A.18. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1708 homozygotes (mostly sterile; occasional progeny arrest as larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TACTTCGTTTCGAGCGTCCT. External right primer: AGTAGGCCGTCAAATTGGTG. Internal left primer: TCCGCCGTCTCTTCTATTGT. Internal right primer: AACAATCCTGTTCCGCTCAT. Internal WT amplicon: 2898 bp. Deletion size: 1490 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1249 +/mT1 II; ula-1(ok1700)/mT1 [dpy-10(e128)] III. C. elegans C26E6.8. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1700 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTTTCCGGGGATATCTAA. External right primer: CGTACTGCCTGCATGAGAAA. Internal left primer: ATGTCATGCCACAAGGAACA. Internal right primer: CATTCTTGTGAAACTCGCCA. Internal WT amplicon: 2184 bp. Deletion size: 930 bp. Deletion left flank: GAATGTTGCCGACTCCTGAGTATGTCCATC. Deletion right flank: GAACGTCGGAAACTCATAAGAATCGCCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC125 tyra-3(ok325) X. C. elegans M03F4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1250 pcaf-1(ok1690) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1251 rae-1(ok1720) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F10G8.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1720 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATACATTCGAACGCGACACA. External right primer: CCAGAAACGCGGTTTAACAT. Internal left primer: GCGCTCTACTGCCAATTTTC. Internal right primer: GGAAAGCACCCGAACTATGA. Internal WT amplicon: 2465 bp. Deletion size: approximately 750 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1252 K08D12.2(gk564) IV. C. elegans K08D12.2. Superficially wild type. External left primer: TCACATGGGTTTCCATAGCA. External right primer: GACAACGCGTGGGATAGTTT. Internal left primer: AGCCTCGAACAATGAGCTGT. Internal right primer: CGATACCTACAAGGAGCCCA. Internal WT amplicon: 1734 bp. Deletion size: 942 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1253 cps-6(ok1718) I. C. elegans C41D11.8. Superficially wild type. External left primer: TCGTGTTTTTGTTTCCTCCC. External right primer: TTGTTCTGATCGCAGTTGGA. Internal left primer: CCTTTTCCACCTTCCCCTAT. Internal right primer: AAGCTTCGGGTGATTTCTGA. Internal WT amplicon: 2220 bp. Deletion size: 676 bp. Deletion left flank: CCTTCCCCTATTTCGGATGAATTTTTGTTG. Deletion right flank: AGTTACGTGTTTTTGCGAAAAACTTCGTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1255 vab-1(ok1699) II. C. elegans M03A1.1. Superficially wild type. External left primer: CACGACGATAAGCGGTTTTT. External right primer: TAAGGCTCGGGTACCGTATG. Internal left primer: GTGTACCTCACCCCCTCTCA. Internal right primer: TCTGATTACGCAGTCATCGC. Internal WT amplicon: 3217 bp. Deletion size: 1016 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1257 H19N07.4(ok1668) V/nT1 [qIs51] (IV;V). C. elegans H19N07.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1668 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Outer Left Sequence: GGTCTTGAACGGGAGCATAA. Outer Right Sequence: ACCTTCGATGATCGGATTGA. Inner Left Sequence: ACGGTTTGGTTTTGAACTGC. Inner Right Sequence: TCAAGAATTGGCGTGAAGTG. Inner Primer WT PCR Product: 2552. Deletion size: 826 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1258 R08C7.2(ok1681) IV/nT1 [qIs51] (IV;V). C. elegans R08C7.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1681 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATACTCGGCCGCTACTCAG. External right primer: TCAACGTCATTGTCACACGA. Internal left primer: ACGAACATTGGGAAAAATCG. Internal right primer: ATGAATTTCCGAGACGTTGC. Internal WT amplicon: 2519 bp. Deletion size: 1152 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1259 K05C4.2&K05C4.11(ok1713)/hIn1 [unc-101(sy241)] I. C. elegans K05C4.11, K05C4.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok1713 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGGAAGACGAATCTTTTCGG. External right primer: AAGGACCACCGTCTTCAATG. Internal left primer: ATTAAAGGTGGCCGGAGATT. Internal right primer: GTGGAGGGTCTGATTGGAGA. Internal WT amplicon: 3304 bp. Deletion size: 810 bp. Deletion left flank: AGTCCGTCCCATCGGTACCCGCCGCTCGAA. Deletion right flank: TTTTTAGATCTTGGATTTTACTGGAAAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC126 rac-2(ok326) IV. C. elegans K03D3.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1260 F58E10.3&aip-1(ok277) V/nT1 [qIs51] (IV;V). C. elegans F58E10.4, F58E10.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok277 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTTTCCGCTTTGTCTCAAC. External right primer: AATTTCTTGTTTGATGCGGC. Internal left primer: GCAGCGTCTTTCTGGAAATC. Internal right primer: GAACGAGCCAGAGCTTCATC. Internal WT amplicon: 2639 bp. Deletion size: 1066 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1261 +/mT1 II; C36E8.1(ok1714)/mT1 [dpy-10(e128)] III. C. elegans C36E8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1714 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGAGGATCCACCCATCATC. External right primer: GAAGCTTGAAGAAGAGGCGA. Internal left primer: TGGAGTCATGAACTTGCTGC. Internal right primer: GAAACTTTCGAGCAATGGGA. Internal WT amplicon: 3294 bp. Deletion size: 833 bp. Deletion left flank: ACATTCTAGAAATGTGTCAAAAAGCTTCTC. Deletion right flank: TTTCAAAATGCTCATTTTGAACTTTTTCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1262 osm-9(ok1677) IV. C. elegans B0212.5. Superficially wild type. External left primer: GTGATACTGCACGATGTGGG. External right primer: ATACATCCGTCCGACAGAGC. Internal left primer: GAAGTTCGATGGACGGGATA. Internal right primer: CGTCCAAATTTCAGATCCGT. Internal WT amplicon: 3260 bp. Deletion size: 1478 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1263 ver-1(ok1738) III. C. elegans T17A3.1. Superficially wild type. External left primer: ACCAATAATTTCATTGCGCC. External right primer: GCTCACCGATTTTTCTTCCA. Internal left primer: ATAAGCAGCCGACACTTGCT. Internal right primer: GTGGAGATCTTCCAACCCAA. Internal WT amplicon: 3191 bp. Deletion size: 1291 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1264 Y62H9A.9(ok1762) X. C. elegans Y62H9A.9. Superficially wild type. External left primer: CCTGAACTCCAAGGACCAAA. External right primer: CTCCAATTTCCGTTCTTCCA. Internal left primer: TTCCTAAATTGTCCCCCTCC. Internal right primer: TCAAAAATCCATCCCATCGT. Internal WT amplicon: 3238 bp. Deletion size: 1380 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1265 F25H5.3(ok1754) I. C. elegans F25H5.3. Superficially wild type. External left primer: TGAAGAGTCTATTTCGGGCG. External right primer: AAAAATAACGCTGGTCACGG. Internal left primer: AAATGCAAGTGGGTACTCGG. Internal right primer: CTGGAACGAATCGTCACTCA. Internal WT amplicon: 3001 bp. Deletion size: 1458 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1266 Y55F3AR.2(ok1737) IV. C. elegans Y55F3AR.2. Superficially wild type. External left primer: TTGAAATTCGGAAAATTCGC. External right primer: GCTTTCAAGCTGAAAAACGG. Internal left primer: GGGTACGGTGGATTTTGATG. Internal right primer: ATAATGTCGCCACCCTCAAG. Internal WT amplicon: 2177 bp. Deletion size: 1044 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1267 +/nT1 IV; urb-1(ok1594)/nT1 V. C. elegans T05H4.10. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and ok1594 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CGCCAGAGACAAAATCCACT. External right primer: CGTTGTGTGGATTGACCAAG. Internal left primer: GACTCACAGAGGTCTTCCGC. Internal right primer: ATATTTCCAGATGGGCACGA. Internal WT amplicon: 2249 bp. Deletion size: 1220 bp. Deletion left flank: TTCTCTTGTGAAAAGATCATGAGCCACAGA. Deletion right flank: TAAATTATTATTATTATCATCCTTAATTTC. Insertion Sequence: AAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1268 K10G6.4(gk567) II. C. elegans K10G6.4. Superficially wild type. External left primer: CGTGGTGGAACTTTTCAGGT. External right primer: CAATTTTCACACATTCCCCC. Internal left primer: CGCAGAGCTTCTCAAACTCC. Internal right primer: AAATGTGGAACCCTGTTTGG. Internal WT amplicon: 1811 bp. Deletion size: 1561 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1269 nhr-148(gk570) V. C. elegans C03G6.10. External left primer: GGAGCATTGATTTTTGGCAT. External right primer: AGACAAATTTGGAACGGCTG. Internal left primer: AGATGGCGAATGGATGTGTT. Internal right primer: TCACCTGGATTACAGCAGCA. Internal WT amplicon: 1912 bp. Deletion size: 1299 bp. Deletion left flank: TAACTCATTGAATATGTAATTATCAACTTT. Deletion right flank: AATATAGGCAAATAGTAGGGACCAAAGGAC. Insertion Sequence: ATAGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC127 pkc-2(ok328) X. C. elegans E01H11.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1270 lin-31(gk569) II. C. elegans K10G6.1. Variable vulval phenotypes. Mostly wild type and able to lay eggs, but some animals have defective vulvae and become bags of worms. Some animals have multiple pseudovulvae. External left primer: TAGACACCCCACCATTCCAT. External right primer: TCGGCTGAACCAAATACACA. Internal left primer: CAGTTCTCGGGTGGTCTGAT. Internal right primer: AGCCTAATCCTAAGCCGGAG. Internal WT amplicon: 2297 bp. Deletion size: 1922 bp. Deletion left flank: TAGTGATGTGAATGTAAAACAAAGACTTAT. Deletion right flank: GCTTAAATTTAGGTTTAGGCTTAGGCTTAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1271 Y40H7A.10(ok1752) IV. C. elegans Y40H7A.10. Superficially wild type. External left primer: CAACGGCAGTTCCATTTTCT. External right primer: TGAAAATTTCGGACAGGAGG. Internal left primer: TGAAGCGAACAACAAATTGC. Internal right primer: GGGCGCTATAGAAGTTGCAC. Internal WT amplicon: 2703 bp. Deletion size: 810 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1272 B0361.2(ok1756) III. C. elegans B0361.2. Superficially wild type. External left primer: TGACCGTTTTCCAAAACACA. External right primer: CAAAATCGGGCGTACTCATT. Internal left primer: ATTTCGACGGTTTACTTGCG. Internal right primer: CAGCCATACTTCCCAATCGT. Internal WT amplicon: 2278 bp. Deletion size: 807 bp. Deletion left flank: GCGAATAGAGAGTTAAAACTTGTGTAATGT. Deletion right flank: CTCTGTATTACTCTTTTATTGTTTTTATAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1273 nhr-28(gk568) X. C. elegans C11G6.4. External left primer: TAGCCTGCATTGGTGTTTCA. External right primer: GGCATACCCGTTTCTTCGTA. Internal left primer: TTTGACCGGTAGACTGCTGA. Internal right primer: TTGAACGGCTGAAAGTTGTG. Internal WT amplicon: 1920 bp. Deletion size: 1543 bp. Deletion left flank: AAACTTACCGTTGGCCACAGATTATTGCAT. Deletion right flank: AATTTCAAAAGTGAAAAGAGTGTGGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1274 H20J04.6(ok1739)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans H20J04.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1739 homozygotes (slow-growing, sickly, mostly sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CCCGGAGCATGAAATTCTTA. External right primer: AATGGAGCTCGAAAATGTGG. Internal left primer: TCCAACGCACAATTGAAAAA. Internal right primer: TCCAGCAAAATATGGTGCAA. Internal WT amplicon: 2146 bp. Deletion size: 853 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1275 C47G2.5(ok1740)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans C47G2.5. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1740 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GTGGAGTGTGAAGGCCACTT. External right primer: AAAGAACCGCAAAATCGAGA. Internal left primer: AATGCACACTCTGCGTTTTG. Internal right primer: TTCTGGTTGAAAATGAGGGG. Internal WT amplicon: 3279 bp. Deletion size: 1176 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1277 C25E10.8(ok1753) V. C. elegans C25E10.8. Superficially wild type. External left primer: GGAAGACAAAACGGGTCTCA. External right primer: AAAAGCAAAACATCGGTTGG. Internal left primer: TAACGGGCTTAAACAGACGC. Internal right primer: GGTTTCGTTCGTCATGGACT. Internal WT amplicon: 2279 bp. Deletion size: 1885 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1278 hex-2(ok1764) V. C. elegans C14C11.3. Superficially wild type. External left primer: GAATTTCGAGGAGAGCATCG. External right primer: TTTCTTGATTGGGAAATGCC. Internal left primer: ACGTGGAGTCAGAATGTCCC. Internal right primer: GGGGACGCAGAAAAATATCA. Internal WT amplicon: 3017 bp. Deletion size: 1894 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1279 sep-1(ok1749) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ok1749. Homozygous sterile deletion chromosome balanced by bli-4- let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1749 homozygotes (sterile Unc adult, often with mid-body constriction). Homozygous hT2[qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTTTTGTACGTCGATTT. External right primer: TCGGATCCTACTCGCTCATT. Internal left primer: AATCGCTCCCAACAGAATTG. Internal right primer: TTATTTCAGTTCCCGGATCG. Internal WT amplicon: 2960 bp. Deletion size: 1234 bp. Deletion left flank: TTTCTCAACTTTCGGACGACGTCCGAACGG. Deletion right flank: GGAAATTGATACGTTATTTTTAAGAATGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC128 mtl-2(gk125) V. C. elegans T08G5.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1280 kin-10(ok1751) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01G9.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1751 homozygotes (grotty adult, dies). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCGCAAAATTTCACGTTT. External right primer: TTCGACAGAAAACTGCTGGA. Internal left primer: GTGACGAAGACAGGCACAAA. Internal right primer: TTCACCCAACCTGTACCCAT. Internal WT amplicon: 2149 bp. Deletion size: 1452 bp. Deletion left flank: TCTTGAGTTTTGTCGGAAAAGAAAATTTTG. Deletion right flank: TTGAGACCTGTCAAATTGAACCGATCCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1282 rabx-5(ok1763) III. C. elegans Y39A1A.5. Superficially wild type. External left primer: TGTGATGGACCAAGTGGAAA. External right primer: AACGGTGGGGGAGATAAAAA. Internal left primer: TTTTGAGGCGCTTAAGGAGA. Internal right primer: TTGAGAAAAAGCCTTTCGGA. Internal WT amplicon: 3134 bp. Deletion size: 1739 bp. Deletion left flank: GGAAAAATTGGAAATTAAATTGGAAAAAAA. Deletion right flank: TATCACTGTCCCGTCAATCATCTGAATCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1283 nhr-127(gk572) V. C. elegans T13F3.3. Superficially wild type. External left primer: GTGCTCGGGAAATATTGGAA. External right primer: AATGCCCTTTCAAGGTTGTG. Internal left primer: TTTCAGGACATTTCCCGTTC. Internal right primer: GTCGAAATCTAGATCGGCCA. Internal WT amplicon: 2368 bp. Deletion size: 846 bp. Deletion left flank: TAAGTTTATAATTATGTTTAAAACTTGCCG. Deletion right flank: GAAAATTACGCTTTTCGGATTGAGAAAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1285 Y43F8C.5(ok1755) V. C. elegans Y43F8C.5. Superficially wild type. External left primer: ATGCTCGGAAATCGAAAGAA. External right primer: ACATGGTTTTCTGTAGGGCG. Internal left primer: GGCAGAAGGTTGCTCATGTT. Internal right primer: GAATTCCGGCTCTTTTGTCA. Internal WT amplicon: 2345 bp. Deletion size: 1316 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1286 Y6B3A.1(ok1736)/hIn1 [unc-101(sy241)] I. C. elegans Y6B3A.1. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok1736 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTTTCACGACGATTTTGGC. External right primer: CAGAGCGACGAAACAAGTGA. Internal left primer: CAACGCTGCGAGAATATCAA. Internal right primer: ACAATGGGTGAAAGTGAGGC. Internal WT amplicon: 2907 bp. Deletion size: 1645 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1287 F45C12.2(gk574) II. C. elegans F45C12.2. Superficially wild type. External left primer: AAACGCTAGAGAGGCACCAA. External right primer: GATTTCGGAATGGTTCGAGA. Internal left primer: AGAGCACGAAGAAACGGAAA. Internal right primer: TCGTGAATCGTCTGAAGCTG. Internal WT amplicon: 2443 bp. Deletion size: 694 bp. Deletion left flank: CTTCAGCTGAAAACCAACTGGTTTATTTGT. Deletion right flank: AAATAACAATTGAAAAATACCCATAGCGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1288 frm-3(gk585) X. C. elegans H05G16.1. External left primer: GGTCATTCTTTGGCACCAGT. External right primer: CCAAGCCGATAACCTCACAT. Internal left primer: TGAACTGAACATCTGCCAGC. Internal right primer: CTCCGCATTCCGACTGTAAT. Internal WT amplicon: 1953 bp. Deletion size: 1390 bp. Deletion left flank: GGTGTGCATCAAAGTTCGTATGCTTGATGA. Deletion right flank: GCAAAGAGATATGAACAGCTCGTTACAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1289 K09C4.5(gk571) X. C. elegans K09C4.5. External left primer: ACAGGAACTTGTCTCCCCCT. External right primer: CTTCCCAAGTGGTCGATGAT. Internal left primer: TATTGAAAGCTTCACCGGCT. Internal right primer: CAACAAATCTGGTTGGGAGG. Internal WT amplicon: 2109 bp. Deletion size: 378 bp. Deletion left flank: TCAGGTTTCGCCTCCACCGCGTTAATTTTC. Deletion right flank: CAGAGTCGCCAAAATGGCTAGTCAGACAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC129 F33H2.5(gk49)/mIs13 I. C. elegans F33H2.5. mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (WT homozygotes), and GFP- sterile Uncs with a vulval blip. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1290 nhr-125(gk578) V. C. elegans R02D1.1. External left primer: TTTCCAACTTTTTGTTCGGG. External right primer: TTACAGGTTTCAATTCCCGC. Internal left primer: GCCACGTGGAATCAAATTCT. Internal right primer: CCCTCATCAAGGTGTAAGCC. Internal WT amplicon: 1462 bp. Deletion size: 467 bp. Deletion left flank: AACATTCCATACAGATTGAATTAGTGTTAT. Deletion right flank: AGAAAGAACTTGAGCAGGCGTTTTTCAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1291 nhr-227(gk580) V. C. elegans T27B7.5. Superficially wild type. External left primer: CTTCCAAAGATTGGCGAGAC. External right primer: GCAAAGTTGAGCGAACATGA. Internal left primer: AAATGGAGCTTGGTCGAGTG. Internal right primer: TCGGAGTGAGCATGAATCTG. Internal WT amplicon: 2251 bp. Deletion size: 1979 bp. Deletion left flank: AATTCATCGCCAAAAAATTTAAAAAAATCG. Deletion right flank: ATTCACTCAATTTTGATAAATTTACCAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1292 fbxa-137&nhr-228(gk581) V. C. elegans T27B7.6, T27B7.7. External left primer: CTCCCAACAACTGCCACTTT. External right primer: CATCAACCACTTTGTCACCG. Internal left primer: GCGATGGACCTGAGAGAGAA. Internal right primer: GCTTAAAGCCTTGCGTCAAC. Internal WT amplicon: 2002 bp. Deletion size: 1353 bp. Deletion left flank: CTTGGCTGTTGGTCAAATTTGAGGAGTACT. Deletion right flank: ACTTAAAAAATTACTATAAAAATGAGGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1293 F45C12.3(gk583) II. C. elegans F45C12.3. Superficially wild type. External left primer: GCTCATTGTGCACCTCCTTT. External right primer: CTGCAACAACGACTGTCCAT. Internal left primer: AGAGTGTGGAGAGCTCGGAA. Internal right primer: CCTACACCCACAGGCTGTTT. Internal WT amplicon: 1871 bp. Deletion size: 722 bp. Deletion left flank: GAGCCATATGCCGTCCGTAAAAGCGAAGAG. Deletion right flank: ACCCAGTGAGCTTGAGCTTGAAAAACTCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1294 nhr-51(gk573) V. C. elegans K06B4.1. External left primer: CGAGTTGACAATCGCAAAGA. External right primer: CAAGCTTGGAGTTGAAAGCC. Internal left primer: AGCGAAACGTGTCATCAGTG. Internal right primer: CAAGCCTTTGACTTCTTGCC. Internal WT amplicon: 1850 bp. Deletion size: 446 bp. Deletion left flank: ATTCTTCCAAAGTGCAAAGCGTGTCGTTAT. Deletion right flank: TGCGAACAGGAGTTTTCCACGGAAGTATGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1295 R12E2.10(ok1781) I. C. elegans R12E2.10. Superficially wild type. External left primer: TGGACAGCTCGTTGTACTGG. External right primer: GAAAGGTCAGAACTCCAGCG. Internal left primer: AAGCCGCTCTAGAAACTCCC. Internal right primer: TTGTCGAGGAGACGGAGACT. Internal WT amplicon: 2457 bp. Deletion size: 1171 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1296 F47C10(gk584) V. C. elegans F47C10. Superficially wild type. External left primer: TCCGATACTTCATGCCAACA. External right primer: ATGGTGGTTTTGTAGCAGGC. Internal left primer: AATCTGCATGATCGGCATTT. Internal right primer: ATACCTACGTGCCTGCCAAC. Internal WT amplicon: 2445 bp. Deletion size: 638 bp. Deletion left flank: GGTAGAGTACCGAAAGCTGAAACTTTGATT. Deletion right flank: ATTTGAAAACATTTATATCAACTTTTAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1297 nhr-202(gk576) V. C. elegans M02H5.4. Superficially wild type. External left primer: CTCTCGCCGAGCTATTTTTG. External right primer: TCAAGTATTTGCCCGTCACA. Internal left primer: GTTGAACCTTGCGCTGAAAT. Internal right primer: TCCAATTTGAATCGATGCTG. Internal WT amplicon: 2294 bp. Deletion size: 521 bp. Deletion left flank: ACAGCAAGTCCGGGGGTCTCAGAGAAAAGT. Deletion right flank: CATCGTTGCGAGTCCCATCGTGGCGAGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1298 nhr-115(gk579) V. C. elegans T27B7.4. External left primer: CCAAATTTCACTGCTCCGTT. External right primer: GAAATTGAAAAAGCGACCCA. Internal left primer: TCTTGACCGTCTGGGTCTCT. Internal right primer: GGCGCTTAACAGAACTTTGG. Internal WT amplicon: 2344 bp. Deletion size: 499 bp. Deletion left flank: TTGAAAAAAAATTTCAGTTGTTTCTGCAAA. Deletion right flank: TCTGAAAATTTGGTCAATATATTTTTAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1299 R07B7.2(ok1771) V. C. elegans R07B7.2. Superficially wild type. Outer Left Sequence: CACTTTGTGCTTGCGATGAT. Outer Right Sequence: ACGTTCGCAAAAGATCAAGG. Inner Left Sequence: ATTCCGAACATTTCACCCAA. Inner Right Sequence: CATCACGCTCCAACAAGAGA. Inner Primer WT PCR Product: 3182. Deletion size: 1310 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC13 dog-1(gk10) I. C. elegans F33H2.1. Mutator (spontaneous mutations occur). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC130 parg-1(gk120) IV. C. elegans F20C5.1. Him. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1300 F28C6.1(gk582)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F28C6.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk582 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATGATAAGACGTCCTTGCCG. External right primer: TGCCTCTGCATTGTTCTCAC. Internal left primer: TGTTTGCACTGTTCGACGTT. Internal right primer: GGCGGATTGATTCATATGCT. Internal WT amplicon: 2222 bp. Deletion size: 1146 bp. Deletion left flank: GCGGTTTTTAAAATAACGTGAATATTGCTT. Deletion right flank: GACAAACACTGAGCGAGAAAACGAATCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1301 ZC506.1(ok1790) X. C. elegans ZC506.1. Superficially wild type. External left primer: TTTGCAATGTTCTGCGTCTC. External right primer: CGGCCATCACTCAAGGTAAT. Internal left primer: ACATCGTTTCTTCAATGCCC. Internal right primer: CCCCATTTCTAAGCTCTCCC. Internal WT amplicon: 2118 bp. Deletion size: 1052 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1302 nhr-101(gk586) V. C. elegans H12C20.6. Superficially wild type. External left primer: TTCTCCCGAGACACTTGCTT. External right primer: GAAGTAGCTTTTTGGGTGCG. Internal left primer: ACCACTTGTGACACTCGCAC. Internal right primer: ATCAGCGATCCAAACAGCTT. Internal WT amplicon: 1824 bp. Deletion size: 624 bp. Deletion left flank: ATATGCTCAAAAAGCATTTGAAACATATTG. Deletion right flank: TATTCAATCTTAAAACCATAAAAATTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1303 Y57A10A.24(ok1793) II. C. elegans Y57A10A.24. Superficially wild type. External left primer: AAAATTCCGCACCAGTAACG. External right primer: CCGTAAATTTGGCCTGAAAA. Internal left primer: GCCGAGGGACTGTAACAAGA. Internal right primer: AACAATCATCCACGTCACCA. Internal WT amplicon: 3356 bp. Deletion size: 1009 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1305 smg-6(ok1794) III. C. elegans Y54F10AL.2. Superficially wild type. External left primer: TAGCTAGCCCATGTGCCTTT. External right primer: TTTTGCGATGTGAATCGTGT. Internal left primer: TTTTAGCCACACCATCCACA. Internal right primer: CCAAAAACATGGGAAAATCG. Internal WT amplicon: 3113 bp. Deletion size: 920 bp. Deletion left flank: CAATTAAAAATTTTTTTTCTTGATTTTCTA. Deletion right flank: AAAATTGTGTCTAGGGGTGAAAAATTGCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1306 VC5.2(ok1796) V. C. elegans VC5.2. Superficially wild type. External left primer: ATTGAACGCGTCACATCAAA. External right primer: ATTCGAGGGGGAAATACCAC. Internal left primer: AGAGAAGACGGTTTGACCCA. Internal right primer: CAAATTTTAGGGAGACGCCA. Internal WT amplicon: 3163 bp. Deletion size: 1645 bp. Deletion left flank: GCAAATTTATCAGTTGCATATGCTTTTGGA. Deletion right flank: AAATTTTTAAAATGGTTCTAGAAAGCTTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1307 F52E4.1(ok1686) X. C. elegans F52E4.1. Superficially wild type. External left primer: AAGAACCTTGATTCGCAGGA. External right primer: GAGTGGAATGTTTCCGTGCT. Internal left primer: CCGTTGAGAACCGATTTGAT. Internal right primer: GTTCAAATCCTCGCACACCT. Internal WT amplicon: 2518 bp. Deletion size: 1301 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1308 eef-2(ok1774) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F25H5.4. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1774 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGGCGCTCTACCGTACTTT. External right primer: AGGCCGAAACAAATTCAATG. Internal left primer: GCAAATTTTGGGCCTACTGA. Internal right primer: AAACGATCTGGTTTGGCTTG. Internal WT amplicon: 2855 bp. Deletion size: 1443 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1309 nlp-8(ok1799) I. C. elegans D2005.2. Superficially wild type. External left primer: TCGGAAATGATTCATAGGGC. External right primer: TCACACCTCATACCCCCATT. Internal left primer: CTTTCAAATCACCCGACCAT. Internal right primer: TTCTTGATCTACCCGAACCG. Internal WT amplicon: 2229 bp. Deletion size: 695 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC131 coh-3(gk112) V. C. elegans F08H9.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1310 cey-1(ok1805) II. C. elegans F33A8.3. Superficially wild type. External left primer: CCGTTTCTCGAAAGTGCTTC. External right primer: TACACTGACCGCTGCTCATC. Internal left primer: AACCGGAGAAGGAGAAGCTC. Internal right primer: GGTCAGCTTACACACTCGCA. Internal WT amplicon: 2614 bp. Deletion size: 539 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1311 cpr-3(ok1788) V/nT1 [qIs51] (IV;V). C. elegans T10H4.12. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1788 homozygotes (mildly Unc, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAACAAATCCACCCTGCATC. External right primer: TCGATTCACCACTGTTTTGC. Internal left primer: CATTGCTCGTCATGTTGGTT. Internal right primer: CCTCAACGCTTTGATAAGCC. Internal WT amplicon: 2200 bp. Deletion size: 1225 bp. Deletion left flank: CACTGCGGATCTGGGATTCAGGTACGCTGT. Deletion right flank: GTGTCACCGAATCAAGAAATCAATTATCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1312 ift-81(gk512) X. C. elegans F32A6.2. External left primer: TGCCTACTTCCAACGCTTTT. External right primer: AACTTCGGCTGTCTTGCCTA. Internal left primer: CAACAAGTCGATGCCTGAAA. Internal right primer: GCGCTCTTTCAAACCTTCTG. Internal WT amplicon: 1863 bp. Deletion size: 269 bp. Deletion left flank: TCAAGGGTTTATTCTCCACTTTTTGAATGA. Deletion right flank: TAAATTTTTTTAATTTCTAAAAATAGCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1313 par-2(ok1723)/sC1 [dpy-1(s2170)] III. C. elegans F58B6.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1723 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAATCACACCGATTTCTGCC. External right primer: AAAATTGGTGCGAAAACGAC. Internal left primer: AGCGGAGTTTTCCGATTTTT. Internal right primer: AAAAAGGCTACGAAACGGGT. Internal WT amplicon: 2390 bp. Deletion size: 1110 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1314 F53B2.3(ok1783) IV. C. elegans F53B2.3. Superficially wild type. External left primer: AATACCGACGCATCAGGAAG. External right primer: CGTTAGTGTGGGCTTTGGAT. Internal left primer: TGGCTCATCATCAGACTTGG. Internal right primer: GATTCATGAGAGGTCTCGCC. Internal WT amplicon: 2254 bp. Deletion size: 929 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1315 T10F2.4(gk575) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T10F2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk575 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACACGTCACCAATGAACGA. External right primer: CGTGGTGTCTCGAATTCCTT. Internal left primer: CATGTCGAAGGACAGGGAGT. Internal right primer: TTCGTTTATGTCCCACGTCA. Internal WT amplicon: 1565 bp. Deletion size: 632 bp. Deletion left flank: TGAATGTTTGCATAACCTGTTCCTTTTCAT. Deletion right flank: AGATAATTGCAAGGTTGACAAACCTGGTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1316 bbs-5(gk537) III. C. elegans R01H10.6. Superficially wild type. External left primer: ACTTCGGTAAATCGACACCG. External right primer: TGTCCGAAGTGGTTTCATCA. Internal left primer: TTCGAGACGGTAAATCAGCC. Internal right primer: GAACCTACTCGCAGGGTGTC. Internal WT amplicon: 1513 bp. Deletion size: 692 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1317 lem-2(ok1807) II. C. elegans W01G7.5. Superficially wild type. External left primer: CGACCGAAATCACGAGAAAT. External right primer: CAGACGGAAGCACAAGAACA. Internal left primer: TCGAGACTCGCAGAGGATTT. Internal right primer: GTAGCGACGCGAGACTCATT. Internal WT amplicon: 2741 bp. Deletion size: 2169 bp. Deletion left flank: CTTAATTTCCGGTGAGATATTCTGTAGTTT. Deletion right flank: CTTTTCCTCGTCCCTCGTGAGGAAAAAGTTGCAGTGTCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1318 Y65B4A.2(ok1809) I. C. elegans Y65B4A.2. Superficially wild type. External left primer: TGATGACTTCCACACGGTTC. External right primer: CGTTCAGCTTCTCGGTTTTC. Internal left primer: TTCGACAAAACATGGTGCAT. Internal right primer: TACTCGTTCCTTTCCATCGG. Internal WT amplicon: 3406 bp. Deletion size: 1338 bp. Deletion left flank: TATCGATTTTTTCCGATAATTATCGATTTT. Deletion right flank: TCCGATAATAATCGACTTTTCCGATAGTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1319 nhr-96(gk589) V. C. elegans F44C8.11. Superficially wild type. External left primer: ATGTTATCCTTCGGCCTGTG. External right primer: GCTAAATTTTGGGTGGCTGA. Internal left primer: GAGCCGAAGGTTTCCTGAAT. Internal right primer: ATTGTGGGCCGCTAAATATG. Internal WT amplicon: 1693 bp. Deletion size: 339 bp. Deletion left flank: TTACTCTTATATTTGGGCCTGCGCATTCCA. Deletion right flank: AAGTTTTTTGAGGGCTGCAGAGTGGTTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1320 nhr-123(gk577) V. C. elegans M02H5.7. Superficially wild type. External left primer: CTGCGAAGAGGTGTGAGACA. External right primer: TGATGGAAGCATAATTGGCA. Internal left primer: ATTCGAAATCGGAGAGCAGA. Internal right primer: ATTGGTCGAAACTGGAATGC. Internal WT amplicon: 2189 bp. Deletion size: 427 bp. Deletion left flank: GGTATTTCAAAAAAATTCAAGCCTTGCAAA. Deletion right flank: CAAGTTCCCAATGTGTTGCAAAAATTAGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1321 nhr-16(gk588) II. C. elegans T12C9.6. External left primer: TTCCTGCCAGGGAAATAATG. External right primer: AAAGTCGTGGATCCGAGTTG. Internal left primer: CTTACCTACCGCCTGCTTTG. Internal right primer: GACGAGTATCCTAGCGGCTG. Internal WT amplicon: 2095 bp. Deletion size: 963 bp. Deletion left flank: TTTTATCTATTTAATATTCACAAGGGTGTA. Deletion right flank: ATAATATGTAGAAGCTTTTGTAAGGTGTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1322 nhr-16(gk587) II. C. elegans T12C9.6. External left primer: TTCCTGCCAGGGAAATAATG. External right primer: AAAGTCGTGGATCCGAGTTG. Internal left primer: CTTACCTACCGCCTGCTTTG. Internal right primer: GACGAGTATCCTAGCGGCTG. Internal WT amplicon: 2095 bp. Deletion size: 559 bp. Deletion left flank: TTACATCAAATGCATCGAAGTTGGAATGAA. Deletion right flank: TTGTTCAGAGTCGGATAGGCAAATTTCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1323 nhr-127(gk593) V. C. elegans T13F3.3. Superficially wild type. External left primer: GTGCTCGGGAAATATTGGAA. External right primer: AATGCCCTTTCAAGGTTGTG. Internal left primer: TTTCAGGACATTTCCCGTTC. Internal right primer: GTCGAAATCTAGATCGGCCA. Internal WT amplicon: 2368 bp. Deletion size: 1608 bp. Deletion left flank: TCCCTGCGAAGTGTGCAAAAATCAATCAAA. Deletion right flank: TTTTTGGAACAGATGTTTAATCATATGGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1325 tbg-1&F58A4.9(ok1786) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F58A4.9, F58A4.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1786 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTCGTTGTTGCGGAATTTT. External right primer: CGCCGAGTTCAAAAAGAAAG. Internal left primer: CTTTCTTCGGAAATGCTTCG. Internal right primer: GCTCAATGTGTTCGCAGAAG. Internal WT amplicon: 2187 bp. Deletion size: 1269 bp. Deletion left flank: GGCTTGAGCAAGCTGATTTCCGCACTGTCC. Deletion right flank: GAGTAAGAAAAAGAAGATCAAAGTGGATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1326 VC5.2(ok1797) V. C. elegans VC5.2. Superficially wild type. External left primer: ATTGAACGCGTCACATCAAA. External right primer: ATTCGAGGGGGAAATACCAC. Internal left primer: AGAGAAGACGGTTTGACCCA. Internal right primer: CAAATTTTAGGGAGACGCCA. Internal WT amplicon: 3163 bp. Deletion size: 1547 bp. Deletion left flank: ACAATGAGCAGAAAAATTGCACGTGAGCCA. Deletion right flank: GTGAGTTTTAAATCGAATTTAAATTTGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1328 F09F7.5(ok1826) III. C. elegans F09F7.5. Superficially wild type. External left primer: CCCCCACACTCTCTAACCAA. External right primer: CAACTACTGAAGGCTCCCCA. Internal left primer: ACCGCCAACAATTCAGTCAT. Internal right primer: GGTTTGATCGATCGTTTGCT. Internal WT amplicon: 3139 bp. Deletion size: 1649 bp. Deletion left flank: CCAATTGTTAAAAGTACACCACCTCTCAAT. Deletion right flank: CACGTACCCAAGTTTCTCTCTGAGACTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC133 C05D11.8(gk47) III. C. elegans C05D11.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1330 abu-14(ok1789)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans ZK1067.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1789 homozygotes (variable arrest, larval through sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGAAAACAGAAGTTGTCGCA. External right primer: GTCAACAAACCAAATGCGTG. Internal left primer: AGAATTCAGGGAAGGGGATG. Internal right primer: CTCCGGTTTCCGAGTATGAA. Internal WT amplicon: 2113 bp. Deletion size: 292 bp. Deletion left flank: AAAAGTAGTATTTAAAAAAGAAATTTACCT. Deletion right flank: GCGTTCGAAACAACTCCTTGAATCGGAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1331 acy-4(ok1806) V/nT1 [qIs51] (IV;V). C. elegans T01C2.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1806 homozygotes (sterile, lays no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTACATTGATTTGACCGCGA. External right primer: CGCCCGTTTCGATAAAGTAG. Internal left primer: CGACTCGCAACATTCACACT. Internal right primer: AGAGTTGGCATTCATACGGG. Internal WT amplicon: 2936 bp. Deletion size: 1318 bp. Deletion left flank: CTTAAATTCTTCCCGATCCAAAATCTGATC. Deletion right flank: ATAACACTGGTGAGAACGATGAACATTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1332 H34C03.1(ok1817) IV/nT1 [qIs51] (IV;V). C. elegans H34C03.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1817 homozygotes (sterile adult, no eggs laid). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTCTCGAAATCCCGTTTG. External right primer: TTTTTCCGGGTCTTACAACG. Internal left primer: ATCGATCCATCGGAACACAT. Internal right primer: TTCAGTGTCTGCCAAAATGC. Internal WT amplicon: 2615 bp. Deletion size: 1056 bp. Deletion left flank: TCTTTCAATTAAAACTTCAAAAATAGATTT. Deletion right flank: ACTGAAAATTGAGGAAATTCAAGAAGGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1333 evl-20&cut-3(ok1819)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F22B5.1, F22B5.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1819 homozygotes (sterile adult, often with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATGAACGCTTTTGCAGAC. External right primer: TGAGAACGGTTGTGCTCTTG. Internal left primer: TACCAATTGGACGAGGAAGC. Internal right primer: TTCTTGATGTCCGTGCTGAG. Internal WT amplicon: 2108 bp. Deletion size: 757 bp. Deletion left flank: TGCTTTAATTTGGGTGGTAGATTCGTCAGA. Deletion right flank: AACGGTAAGACCAAGGAAGACAGTGACAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1335 F11A5.4(ok1841) V/nT1 [qIs51] (IV;V). C. elegans F11A5.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1841 homozygotes (probable embryonic/early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCTATGGAAGCGACTGTTG. External right primer: TGCTTGCTTCATTTTTCACG. Internal left primer: TTATCCCTTTTCCCCATTCC. Internal right primer: ATACCTGCCATTGGACTTCG. Internal WT amplicon: 2332 bp. Deletion size: 997 bp. Deletion left flank: TTTTTTTGAATATTTGGGTCAAATTCCTAA. Deletion right flank: AACTGGATTTCAGTTGTATTTGCGCACGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1336 vha-6(ok1825)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans VW02B12L.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1825 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAGAATGGCTCGAACT. External right primer: TCATCCATCATTCCAGAGCA. Internal left primer: GGAACTCGACCCAATGAAGA. Internal right primer: GGTGGCGGTCTGATATTGAT. Internal WT amplicon: 3301 bp. Deletion size: 982 bp. Deletion left flank: GGCTTGACGAGAAGCATAACTGGAACAGAT. Deletion right flank: GGAGCTGGATTAACTTCTCGATAGTTGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1339 Y49A10A.1(ok1856) X. C. elegans Y49A10A.1. [NOTE (10/28/11): Possible deletion/duplication event; genotype being confirmed by Moerman and DeStasio Labs] Superficially wild type. External left primer: GAAATTCATATCGCCCAGGA. External right primer: ACAGAAACGTAGCTGAGGGC. Internal left primer: ACCTTTCCATGTAACCCACG. Internal right primer: GGGTGATCAAAACGTTCCAT. Internal WT amplicon: 2286 bp. Deletion size: 1188 bp. Deletion left flank: ATTCCAAAAATGTCGTTTAGAAGTTTTGAA. Deletion right flank: GCTATTTTTGAAGAGGATCGCTCTTCCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC134 pgp-2(gk114) I. C. elegans C34G6.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1340 C52B9.11(gk596) X. C. elegans C52B9.11. Superficially wild type. External left primer: CCAAACGCACAGCAATTAAA. External right primer: ATTGTGCACTGCTGGTGAAG. Internal left primer: TCGTAAACTATGCAGCGCAC. Internal right primer: CCGCATTTAAACATGGAAGG. Internal WT amplicon: 2173 bp. Deletion size: 1435 bp. Deletion left flank: ATGCAAACACAAACTTTTTGTTTAGCATAT. Deletion right flank: TCGCTACTTTTTTGCTGTCTGTTCAACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1341 dnj-19(gk595) V. C. elegans T05C3.5. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 710 bp. Deletion left flank: GGATGGCCATCAAGATGTTTGATAAGGAAA. Deletion right flank: CATCGTCATCACCGCCAGCACCGCCGAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1342 taf-11.1(gk594) X. C. elegans F48D6.1. External left primer: AACCCAGTTTGGCTTTTGTG. External right primer: ACTAAACTGCGCCGACATCT. Internal left primer: TAATGCAAATGGGAATGCAA. Internal right primer: CGGCAAATTGTTGATCACTG. Internal WT amplicon: 2477 bp. Deletion size: 583 bp. Deletion left flank: GAAGAAGCGTAAGATTTTATAGAAGAAGTA. Deletion right flank: GTGACATAAATGAGGAAGAAGCTAGCAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1343 plk-1(ok1787) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C14B9.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1787 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTAGCACCCTTTTTCATCGG. External right primer: GCAGATCCCATTGGCATAAT. Internal left primer: AATCGACTTCCCAACATTGC. Internal right primer: TGGGACTAAAAGGGTCGATG. Internal WT amplicon: 2510 bp. Deletion size: 1798 bp. Deletion left flank: AAGGCGGTCACCGAACCTGAAGCTCGTTAT. Deletion right flank: GCCACGGTCAATGGCAGCTGCTCGTTCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1344 T09B4.9(ok1792) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T09B4.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1792 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTTCAGGCATTATCCA. External right primer: TCAAAATTGCATCACTGGGA. Internal left primer: TCTTCGCTCCGAATTGAACT. Internal right primer: TTGTGGAAACGGGATACGAT. Internal WT amplicon: 2834 bp. Deletion size: 1635 bp. Deletion left flank: AAAAGTTGAGATTTAATTAGGACACTGAGA. Deletion right flank: TTCTCCAAATCGAACCCATCTGTCCGTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1345 mtch-1(ok1800)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F43E2.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1800 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGCGTATCAAGTCGCTCGTT. External right primer: AAACCTCAGCGGTCAGAAGA. Internal left primer: ATTGGATGGATCATCGGGTA. Internal right primer: GCATCTTCCTCGACTTGTCC. Internal WT amplicon: 2135 bp. Deletion size: 1182 bp. Deletion left flank: CTCGAAAAATACATTATAGCGAAGATTGGA. Deletion right flank: ATTTCTCCTGTAAAACTGAATTTCAAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1346 F59B2(ok1801) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F59B2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1801 homozygotes (sterile, Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGCTCAGCAAGAAAATGAG. External right primer: GTGCTCGATGTCCACACAAC. Internal left primer: ATACCGCCTGCAATTTTCTG. Internal right primer: GCTTTTGAAATCGAAGCGAC. Internal WT amplicon: 2606 bp. Deletion size: 829 bp. Deletion left flank: TTAACAAGAAAAAATGATTTTAAAACCGTG. Deletion right flank: AAAAATTAACATGTCGAGAACCTAAGTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1347 K01H12.2(gk599) IV. C. elegans K01H12.2. External left primer: TCCGTGATATGTTGTTCCGA. External right primer: TCACCTCGATTCCACATGAA. Internal left primer: TGACTATGTGACGAAACGGC. Internal right primer: CGTTGCGGAATTCTTTGATT. Internal WT amplicon: 1650 bp. Deletion size: 533 bp. Deletion left flank: TAAGCGGCACGGTAGATGATGATACCTTGT. Deletion right flank: GTTCCTCCCGAGGCGAGATCAATCAAGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1348 dnj-19(gk649) V. C. elegans T05C3.5. Superficially wild type. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 931 bp. Deletion left flank: TAAGGAAATTATAGCCGCAAAGTGCCTCAT. Deletion right flank: CGGCCTGCGAAGCGTCTGGTCTCACATTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1349 nhr-47(gk954) V. C. elegans C24G6.4. Superficially wild type. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 742 bp. Deletion left flank: TTAATAATTCAATAATGTAAATTATTGAAT. Deletion right flank: GTAAGATCAATTTAACAAGCATCAAACATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC135 tag-4(gk128) I. C. elegans ZK337.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1350 imb-3(ok1795) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C53D5.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1795 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGGGGGAACAATGAGGACT. External right primer: AACCTCATCGACGATTCTGG. Internal left primer: GGGAGAAGTGGTGGAACAAA. Internal right primer: TGTTATCGCTTTCGCTGTTG. Internal WT amplicon: 3104 bp. Deletion size: 1411 bp. Deletion left flank: AGATTCTCGGAAGATTCTGATTTTCTGGTC. Deletion right flank: TTCATTCCGTCTCCGAGAAGGTTCAGGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1351 C17E7(gk600) V. C. elegans C17E7. Superficially wild type. External left primer: TTGAGGACGGAGTTGCTCTT. External right primer: TCTCCACTGCTTGTTGATCG. Internal left primer: TCCAAATACCGTAGCCCATC. Internal right primer: TCCACCGTCTCTAAGCGAAT. Internal WT amplicon: 1642 bp. Deletion size: 608 bp. Deletion left flank: CGAGGACAACGTGAATATTGCAAAGAGCAA. Deletion right flank: TTTTGTGAGATAAATTGCCTCAACCCTGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1352 nhr-166(gk613) II. C. elegans C49D10.2. Superficially wild type. External left primer: CACCATACCGATTTTCGCTT. External right primer: GTGATTATCGCTTTTCCCGA. Internal left primer: TGAAACCAATTGTACCAGCG. Internal right primer: CAGATCACAATGATGCCCAG. Internal WT amplicon: 2288 bp. Deletion size: 751 bp. Deletion left flank: TATTTGATGGAGAAGTACTATACATGTAGA. Deletion right flank: TCTGGTTCGTCAGGAATCCCGACTCAGTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1353 nhr-166(gk601) II. C. elegans C49D10.2. Superficially wild type. External left primer: CACCATACCGATTTTCGCTT. External right primer: GTGATTATCGCTTTTCCCGA. Internal left primer: TGAAACCAATTGTACCAGCG. Internal right primer: CAGATCACAATGATGCCCAG. Internal WT amplicon: 2288 bp. Deletion size: 402 bp. Deletion left flank: TCGCCATGAAGTGTTCAAGATTATCGACAC. Deletion right flank: AACAAAATGGACTTTTGTAAGGATCTAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1356 nhr-214(gk604) X. C. elegans T07C5.3. Superficially wild type. External left primer: TTCGCATAGGATTGTTGCAG. External right primer: GGTTGGCTTCTGCAGTTTTC. Internal left primer: GTTTGTTCTCACTGGACGCA. Internal right primer: ATCACAACGACCGGCTATTC. Internal WT amplicon: 1847 bp. Deletion size: 337 bp. Deletion left flank: CGATTGAAACGAGACGTTGGAAAATTAGTA. Deletion right flank: TGCTCCTTTGAAAAAGTATTTCAAATCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1357 H04M03.4(ok1750)/nT1 IV; +/nT1 V. C. elegans H04M03.4. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and ok1750 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACGGAAATTGTGCCGTTAAT. External right primer: TTTTGCGAATTTTTCATCCC. Internal left primer: AATGTTTCAGGAGGCCATTG. Internal right primer: TATCCCCGTGGAATAGTTGG. Internal WT amplicon: 3042 bp. Deletion size: 1376 bp. Deletion left flank: AGAAGTTGCCAAATGAGTGGTTCAAGTTCA. Deletion right flank: TATATGTGCTATATAATTCTCATAATTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1359 K02B12.3(ok1827) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K02B12.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1827 homozygotes (probable embryonic/early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATGGAGAAGGATGGACCC. External right primer: TGGAACAAGAACCGGAAAAC. Internal left primer: TGAGAAATAGTGAAGCGCGA. Internal right primer: CTATTTGAACACCCGCCAAT. Internal WT amplicon: 2550 bp. Deletion size: 1420 bp. Deletion left flank: AAAATTCGGATTTAATTATTTAGATAGAAG. Deletion right flank: CCACGTGTTCTCGTTGAAAATCGCTTTCGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC136 tag-4(gk127) I. C. elegans ZK337.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1360 Y48G1C.7(ok1850) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y48G1C.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1850 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGGGTCGACTATCACATCA. External right primer: CTCGCAGAGCTCACAAAGTG. Internal left primer: CACAACCACTTGTTCGAGGA. Internal right primer: CGCGTGTAGGATCCATTTTT. Internal WT amplicon: 3378 bp. Deletion size: 985 bp. Deletion left flank: AATTAGATAAAAATTGGATTTTCAGCACAT. Deletion right flank: TTTTTTACTTTCGGAACGTCCCACTTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1361 F54F2.9(gk590) III. C. elegans F54F2.9. External left primer: AATCTCCGCTCAATTTGGTG. External right primer: AGGAAGATCGTTTGGCAATG. Internal left primer: ATTTCATCAAACCCGACCAA. Internal right primer: TGACTTTACCTCGCCGATCT. Internal WT amplicon: 2163 bp. Deletion size: 1049 bp. Deletion left flank: CTTCTCTGTTGAGCCAACTCCTCTTCTGTT. Deletion right flank: AAGGATATTAGGAAGGCAAGGAGAAGGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1362 taf-11.1(gk648) X. C. elegans F48D6.1. External left primer: AACCCAGTTTGGCTTTTGTG. External right primer: ACTAAACTGCGCCGACATCT. Internal left primer: TAATGCAAATGGGAATGCAA. Internal right primer: CGGCAAATTGTTGATCACTG. Internal WT amplicon: 2477 bp. Deletion size: 794 bp. Deletion left flank: TACCAAGCATTGATTCAACAACATCAGCCG. Deletion right flank: ATATAATCAGATTCTAATGAAAAAAAGTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1363 nhr-203(gk660) I. C. elegans M02H5.5. Superficially wild type. External left primer: CTGCGACACAGAAAAGTGGA. External right primer: AACTCGAGCACCAGGAAAGA. Internal left primer: TTGCTACATTTGGAACCGCT. Internal right primer: CGATCTCGATCGACTGTTCA. Internal WT amplicon: 2197 bp. Deletion size: 823 bp. Deletion left flank: TTATTTTTCTTGGAAAAACATTTTTCCAGA. Deletion right flank: AAAGTGCGAATGTTGTGCTTCAGATTGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1364 nhr-206(gk603) V. C. elegans R07B7.13. Unc. External left primer: TCTTCCCGAAAAATGTGAGG. External right primer: TCTACATCCTGGGCAAATCC. Internal left primer: AACCCTGCTGTCGGTTATCA. Internal right primer: TGCAACTTGTCTCCCAGTGA. Internal WT amplicon: 2310 bp. Deletion size: 1859 bp. Deletion left flank: TGTAAGTTTTTTGTAAAATATTTCTTTGTA. Deletion right flank: CGGACGATAATCGGGAAACAGGCAATCTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1368 klf-3(gk612)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F54H5.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk612 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTGCGCAATATCCAGAGA. External right primer: TCATCATTGACTTCCCACCA. Internal left primer: CCGAAAGAGAGTGAAGACGG. Internal right primer: TAAGCTGATCGTTGACCGTG. Internal WT amplicon: 1778 bp. Deletion size: 571 bp. Deletion left flank: TTCCTCTCCCGCAATTTGAATTTTTTCTCT. Deletion right flank: CCATCAAAATGGAGATTCCCATGCATCCGT. klf-3 was formerly known as mua-1. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1369 rpn-10(ok1865) I. C. elegans B0205.3. Superficially wild type. External left primer: CTTTTTAAGCGGTGCGTCAT. External right primer: GCTCGATATTCCATCCGAAA. Internal left primer: TGGGTCTCTTCTCGCATCTC. Internal right primer: TGCACCAACAACTCCACATT. Internal WT amplicon: 2184 bp. Deletion size: 1166 bp. Deletion left flank: CAGAATCCGCGGCACCTCCATTTGCAGCAG. Deletion right flank: TATGAACTCTGTAGAATGTGAGAAATAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC137 R02D3.5(ok269)/dpy-9(e12) IV. C. elegans R02D3.5. Heterozygotes are WT and segregate WT, Dpy-9 and grotty sterile adults with vulval blip (ok269 homozygotes). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1371 H32C10.2(ok1874) IV. C. elegans H32C10.2. Superficially wild type. External left primer: TGGAAAATTAACAAACGCCC. External right primer: CAATGCATGCAATACGCTTT. Internal left primer: ATGAGCCGTGGCTACTATCG. Internal right primer: CCGTATGCACGTTTGAGAAA. Internal WT amplicon: 2524 bp. Deletion size: 1262 bp. Deletion left flank: GTTTCTAATAAATCCTCAAACATTTATGTT. Deletion right flank: CATTTGAAAAAAGAACAATCTTGAATATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1372 rab-21&cyn-11(ok1879) II. C. elegans T01B7.3, T01B7.4. Superficially wild type. External left primer: TTGCGGAATATCTGCCTTTC. External right primer: ACCCGCGCACTTTATTATTG. Internal left primer: TCTGAGAACGCGTATTGTGC. Internal right primer: GGAATGCTTTCGATGGCTAA. Internal WT amplicon: 2155 bp. Deletion size: 1096 bp. Deletion left flank: TTTTTATTTCGAGAACCCAGTTCTTAACCT. Deletion right flank: GAGAACTAATGACGTTGGAGACATTTATCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1374 F44C4(ok1818) V. C. elegans F44C4. Superficially wild type. External left primer: AACCTGTCAGGAAGACCCCT. External right primer: TTGTTGGGTTCAACAGGTCA. Internal left primer: AGACGCACCAAATTATTGCC. Internal right primer: TTTATTTTTCCGCCGATGAG. Internal WT amplicon: 2872 bp. Deletion size: 1262 bp. Deletion left flank: AATGATTATGCATCGAGAGTCAAATGTTGA. Deletion right flank: AAAATAACCAATTTTATTACTCATCGGCGG. Right breakpoint uncertain, as deletion involves apparent complex rearrangement in region of right primers. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1376 +/szT1 [lon-2(e678)] I; F13E6.5(ok1828)/szT1 X. C. elegans F13E6.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1828 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGAGGAGTGGGATCAATG. External right primer: GCGTTTCACGGATACTTGTG. Internal left primer: CTTTGAAATTTCCCCTGCAA. Internal right primer: AATAACGCCACCTGCAAAAG. Internal WT amplicon: 2983 bp. Deletion size: 1090 bp. Deletion left flank: GATCATCAAGCATTTTTTTGATATCATGTA. Deletion right flank: ATTGTGTAATTTTCAGCATCTTCTTGTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1378 ZK1251.9(ok1867) IV/nT1 [qIs51] (IV;V). C. elegans ZK1251.9. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1867 homozygotes (sterile adult, lays no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGTTCCGACAATTCTTTGC. External right primer: TCGAACTCACCGAAGAACAA. Internal left primer: AGCGGATAGTGGACGAGAGA. Internal right primer: CAGAGCATGAAGCCGTATGA. Internal WT amplicon: 3213 bp. Deletion size: 1162 bp. Deletion left flank: TCATCTGTTGAATGAGAACGTGTAGCCATT. Deletion right flank: TTTTTCGGATAGAATCCGCTTCTGTCAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1379 nhr-267(gk602) IV. C. elegans H22D14.1. External left primer: TGGGTTTTTAACGGGACGTA. External right primer: TTTTCCCTCACCTCATCCAG. Internal left primer: CGTTGCCATACATTCGAAGA. Internal right primer: CGTCTGCCTTCCAACTTTCT. Internal WT amplicon: 2278 bp. Deletion size: 974 bp. Deletion left flank: GTGCAGCGGTAACTCCAATATAATGCTCTC. Deletion right flank: AGGCTCGGCACACCCATTTCTTTTCTGTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC138 elo-1(gk48) IV. C. elegans F56H1.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1380 T11A5.6(ok1866) V. C. elegans T11A5.6. Superficially wild type. External left primer: TTTCTCGATGGTCCTTCTGG. External right primer: CGGGACGTTTCAAATGCTAT. Internal left primer: TAGTGTTGAGCGTTTGGTGC. Internal right primer: AAAGCTCCTTTCCTGTGCAA. Internal WT amplicon: 3049 bp. Deletion size: 1156 bp. Deletion left flank: CAGAAAGTATCAACATCATCAACACTACTA. Deletion right flank: AAAAAACTAGAGCTAGTTTTATGTGTAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1382 Y71F9AR.2(ok1893) I. C. elegans Y71F9AR.2. Superficially wild type. External left primer: CTGGAATCCGTTGCTTTGAT. External right primer: CGGTGGCCTAAATTTTCTCA. Internal left primer: TATCGATGCTGTTCACCTGC. Internal right primer: GAAAAGTGATCGACTGGGGA. Internal WT amplicon: 3128 bp. Deletion size: 1640 bp. Deletion left flank: TGTGAAGATCGAGAGGAGGATCGGAGAGCG. Deletion right flank: TGTTTTTTAATCAATAATAATCTCAGCCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1383 dgk-5(gk631) II. C. elegans K06A1.6. Superficially wild type. External left primer: AATAAGGTGCTCACCGATGG. External right primer: TTTAATTTGGAGTCGCCAGG. Internal left primer: CTTCGTGAATTCGTCGCATA. Internal right primer: GGAGGCGTCAGGTGAGAATA. Internal WT amplicon: 2256 bp. Deletion size: 1353 bp. Deletion left flank: GGACTGTCCGTCCAGTTTCTTCTCGCTCAG. Deletion right flank: TACTCATTTTTACGCTGCTCTGCCTTCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1384 C26E1.3(gk644) V. C. elegans C26E1.3. Superficially wild type. External left primer: TGCGTGATTTACAGGTGAGC. External right primer: TCCAGGGCAATATTTTCAGC. Internal left primer: GGACGATACGTTGGGCAATA. Internal right primer: TTCTGAGATGCTGTTGCCAG. Internal WT amplicon: 2016 bp. Deletion size: 549 bp. Deletion left flank: GTGACATGTTCAACTCGAACTGTTCTATAT. Deletion right flank: CATTTGTTTCAGCGTCCCAAGCACAAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1386 nhr-207(gk632) V. C. elegans R07B7.14. Superficially wild type. External left primer: TACCAACGCCCTGACTCTCT. External right primer: GTGGAAGCACCAAAAAGCTC. Internal left primer: GTAGAGACGCAGAACGCACA. Internal right primer: CTGCGTACCCAACCTTTCTT. Internal WT amplicon: 2224 bp. Deletion size: 1438 bp. Deletion left flank: ACAGATGAGGAAACGAAATGCGACCCCAAT. Deletion right flank: CCATTTTGGTTAGTCCGTTGTATGATGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC139 R13H4.2(gk115) V. C. elegans R13H4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1390 vps-35(ok1880) II. C. elegans F59G1.3. Small. External left primer: AAAATTCGGGGAATACGACC. External right primer: TTTCCATGGACCTGAACACA. Internal left primer: GATCAGTCGATTCGGGTTGT. Internal right primer: TATTCTGACGGGAAAGGTGG. Internal WT amplicon: 3041 bp. Deletion size: 1590 bp. Deletion left flank: CATTTGGCAACATTAACCGAGTTTTTGAAT. Deletion right flank: CGATCACATTGAAGAGCTTATCGCACGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1391 cdc-25.1(ok1888) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K06A5.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1888 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGGAGACCTGCAAAGTGT. External right primer: AAAAGTGGCTTGTTCATGGG. Internal left primer: GTGCTATTATTCGGCGTCGT. Internal right primer: TCAATCACGGTCCTTTTTCC. Internal WT amplicon: 2246 bp. Deletion size: 1512 bp. Deletion left flank: CCTGGAGCCCAAGTTGAACAATGCGCTCTT. Deletion right flank: ATCATAGTTGTAGCTGAAAATTGTTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1392 zip-5(gk646) V. C. elegans C34D1.5. External left primer: ATACGCGTGCTCTTTGTCCT. External right primer: CCACATCATGATCACTTCCG. Internal left primer: TTGTGGTTTGGTCCCACTTT. Internal right primer: CACCCAAATGTCACAAGACG. Internal WT amplicon: 2130 bp. Deletion size: 2008 bp. Deletion left flank: ACGATGTTACAGCTTTTCTTATCTTTGTTT. Deletion right flank: AGTTAACAAACATGAAACACGACCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1393 hcp-3(ok1892) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F58A4.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1892 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCTTGCACGATGCTACCTG. External right primer: AAACAGAGCGATTAGCCGAA. Internal left primer: CGTGGTCAATTTCAGAGCAA. Internal right primer: ACTCGGTTAGCAGGCACACT. Internal WT amplicon: 2320 bp. Deletion size: 1169 bp. Deletion left flank: CTTGAAGAGCACTGATGGCGTCAGAACGAA. Deletion right flank: AAATATTCCATCAAAACTTCACGAAACTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1395 mdt-30(ok1791) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F44B9.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1791 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACAATGCGTTGGGTATCAG. External right primer: TCCCAGATGAAGCAATGTCA. Internal left primer: TCAGCCGCCAAGTTTTTAAC. Internal right primer: CAATGAATCCGAATCAACCC. Internal WT amplicon: 2678 bp. Deletion size: 1412 bp. Deletion left flank: CTTGATTCAATGGCTTCCGTTCCATTACTT. Deletion right flank: GAGTAAAAAAGTAAAATTTCGTGTTTGGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1396 +/mT1 II; klp-6(ok1869)/mT1 [dpy-10(e128)] III. C. elegans R144.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1869 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGCCAGATGAGGAAACAACA. External right primer: CTCAGGTGACACCAAAACGA. Internal left primer: TCGAAGATCTTGGCAGAGGT. Internal right primer: ACATACCCCAACTCAGTGGC. Internal WT amplicon: 3130 bp. Deletion size: 1991 bp. Deletion left flank: ATCGAGAAGGCTGTGTATGTGTGTCAACTT. Deletion right flank: AACAGAACGAGCTCTTCGTGAACTCCGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1397 +/mT1 II; F25F2.1(ok1876)/mT1 [dpy-10(e128)] III. C. elegans F25F2.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1876 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGAGTATCGCGCATCATA. External right primer: TCCATTGCATCCAAACGTAA. Internal left primer: CCGAATGGCGAGAGATGTAT. Internal right primer: TTTGTTGGCAATGAGTGCAT. Internal WT amplicon: 2539 bp. Deletion size: 1864 bp. Deletion left flank: GACGGATCATGTGGTCATTGCTGAGAAGTT. Deletion right flank: GAATCTGCAGAAGCAGAAGCAACTGCTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1398 R13.4(gk643) IV. C. elegans R13.4. External left primer: TGAGGAGCGCTTTCTCTAGC. External right primer: TGTTTGGCAGGTGTGAACAT. Internal left primer: TTCGGATCGGAAGAGAGTGT. Internal right primer: ATCCAGCTTGTCGCTTGTTT. Internal WT amplicon: 1980 bp. Deletion size: 493 bp. Deletion left flank: TCAGGACCTTCACAAATGGCCGGACATCCA. Deletion right flank: GATTTTTATCAAGGACTTCTTGATAAGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC14 rap-2(gk11) V. C. elegans C25D7.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC140 eif-3.K(gk126) V. C. elegans T16G1.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1400 cdk-1(ok1882) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T05G5.3. Homozygous sterile deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1882 homozygotes (sterile Unc with withered tail). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTAAGCAATGGTCTCGCA. External right primer: CGACAACAATGGAAACATCG. Internal left primer: CGCTTACGCCTTTTCTATCG. Internal right primer: ACCATTCTCTCGTGAATCCG. Internal WT amplicon: 2136 bp. Deletion size: 764 bp. Deletion left flank: TCGACAACAATGGAGCAATCAAGCTTGCCG. Deletion right flank: CGATAAATAAATTCGCTCTACTTTCATGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1401 cul-4(ok1891)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F45E12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1891 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATGTTTCAACAAGCAGCGA. External right primer: AGTGGCACGGATAAGGATTG. Internal left primer: CACAACCGCAACAAATGAAC. Internal right primer: GATGAGTGATTCCAGGCGTT. Internal WT amplicon: 3035 bp. Deletion size: 744 bp. Deletion left flank: TCAGACGACACAACTCTCGATCAAATGGTA. Deletion right flank: AGAAGGAAGGTACTGTGGAAAATTTGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1402 mef-2(gk633) I. C. elegans W10D5.1. External left primer: CCCTGTTGGATCTCCTGAAA. External right primer: TCATCACACAACACACCACG. Internal left primer: AAGAAGGCAGGCTCGTGTAA. Internal right primer: CCACCTACTCCATACCGCAA. Internal WT amplicon: 1885 bp. Deletion size: 1075 bp. Deletion left flank: TATGAAAAATCATGGTAACCTCCAGAGATT. Deletion right flank: TAATTTTTATCAAAAAATTGTCAGAACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1403 Y71H2AM.1(ok1854)/sC1 [dpy-1(s2170)] III. C. elegans Y71H2AM.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1854 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GCACCATCTCCGGGATATAA. External right primer: CCGTAAATTGACACAACCGA. Internal left primer: CGCCAAAACTCATCGAATCT. Internal right primer: CTCTTGAGCTCAGGCTTCGT. Internal WT amplicon: 2882 bp. Deletion size: 1642 bp. Deletion left flank: TCATACGTCGAGCAAGGAGTTGCTCATTGT. Deletion right flank: CAATTTTTTCACTTATTTTTATCTGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1404 K04G2.6(ok1877) I. C. elegans K04G2.6. Superficially wild type. External left primer: CTCGTCCATATTTTTCGCGT. External right primer: ATCGGTTACATGGCACAAGG. Internal left primer: TGCGATTCTTGTCTTGTTGG. Internal right primer: CCATCCCTGGTGCTAACAGT. Internal WT amplicon: 2895 bp. Deletion size: 1441 bp. Deletion left flank: GCGCTTGATAAGCTCGAAAGCCAAGTTATC. Deletion right flank: GCTGAAATATATCAAGTACGACGTCGTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1405 nhr-46(gk654) IV. C. elegans C45E5.6. Superficially wild type. External left primer: TCGTCGTTGTACGGGATGTA. External right primer: CTGTGCGAGAAACCAACAAA. Internal left primer: TCCATCCGAAAGCCATAAAG. Internal right primer: AGGGTATTCGAAGGGCAGAT. Internal WT amplicon: 1710 bp. Deletion size: 789 bp. Deletion left flank: TAAAAAGAAAAAAGATTCTATCTAGTGCAC. Deletion right flank: GATCTGCCCTTCGAATACCCTAAAAGAGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1407 R13.4(gk655) IV. C. elegans R13.4. Superficially wild type. External left primer: TGAGGAGCGCTTTCTCTAGC. External right primer: TGTTTGGCAGGTGTGAACAT. Internal left primer: TTCGGATCGGAAGAGAGTGT. Internal right primer: ATCCAGCTTGTCGCTTGTTT. Internal WT amplicon: 1980 bp. Deletion size: 263 bp. Deletion left flank: AACGAGCCGCTGGACGGCCTGGCATGATGC. Deletion right flank: AACAAATGCAGTATGGTCATATGGTTAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1408 magi-1(gk657) IV. C. elegans K01A6.1. Superficially wild type. External left primer: TGAATGAGTGTCCCCCTCTC. External right primer: ATCAACTTGCTCCCATCCAG. Internal left primer: ACAAATCGGCAATCCGTTAC. Internal right primer: CCCATGTTGTTGTTCCAGTG. Internal WT amplicon: 2178 bp. Deletion size: 390 bp. Deletion left flank: TCTAAAAATCTATTTCTGTCAATTCTTTAA. Deletion right flank: AAACATTGTTGTATTATGTTCTAATAGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1409 K01H12.2(gk652) IV. C. elegans K01H12.2. External left primer: TCCGTGATATGTTGTTCCGA. External right primer: TCACCTCGATTCCACATGAA. Internal left primer: TGACTATGTGACGAAACGGC. Internal right primer: CGTTGCGGAATTCTTTGATT. Internal WT amplicon: 1650 bp. Deletion size: 528 bp. Deletion left flank: CCATCTTGGCAGTGTCGAACATTCCGAAGT. Deletion right flank: CGGAGCCACAGCAGTCTTGGAGACAGCGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC141 zif-1(gk117) III. C. elegans F59B2.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1411 nhr-98(gk658) V. C. elegans M02H5.6. Superficially wild type. External left primer: AGATCTCCAACCAACCAACG. External right primer: GACCCGCAATTTTCACAGTT. Internal left primer: TGCCAATTATGCTTCCATCA. Internal right primer: CATGACCATGTCATCCTTGC. Internal WT amplicon: 2395 bp. Deletion size: 1560 bp. Deletion left flank: ATCCCGGCACATTTTTGAATGCTTAAAGTA. Deletion right flank: AATAAGACTAATGAAATAGGTTCACTTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1413 nhr-135(gk659) V. C. elegans VC5.5. Superficially wild type. External left primer: CGATTTTTGAACCGAGGAAA. External right primer: AGCACAGTCTTTTCCGCCTA. Internal left primer: GATGCTTTGATCGCTAAGCC. Internal right primer: TTCTGTGTGTGTACGTGCGA. Internal WT amplicon: 1924 bp. Deletion size: 1600 bp. Deletion left flank: GATTTCGATGCTTTGATCGCTAAGCCCGTC. Deletion right flank: TCTAGAGCCAAAGTGACACTCATTGGCAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1414 F46F6.2(ok1673) X. C. elegans F46F6.2. Superficially wild type. External left primer: TTTGCTTTTTGCTTTTTGGG. External right primer: AGCGAACGTCTTCGGAGATA. Internal left primer: ACAGCTCCTGCTGAAATGGT. Internal right primer: CACTGAATGGTGGCTCTCCT. Internal WT amplicon: 3253 bp. Deletion size: 1064 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1416 nrx-1(ok1649) V. C. elegans C29A12.4. Mildly Unc. External left primer: CGGAAGCAAAGAAACCAAAG. External right primer: CTCTTGGCCAGATGTTCGAT. Internal left primer: TTATGCGGGAGATGAAAAGG. Internal right primer: GTTGAGCATTTGCAATCGAA. Internal WT amplicon: 3130 bp. Deletion size: 861 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1417 T10F2.4(gk647) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T10F2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk647 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACACGTCACCAATGAACGA. External right primer: CGTGGTGTCTCGAATTCCTT. Internal left primer: CATGTCGAAGGACAGGGAGT. Internal right primer: TTCGTTTATGTCCCACGTCA. Internal WT amplicon: 1565 bp. Deletion size: 820 bp. Deletion left flank: ATCAGCAGAAGCAGAGATTGCAGTAATATT. Deletion right flank: GAGACTTGAGAGACGACTGGGTCTTCGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1418 F44F1.3(ok1878) I. C. elegans F44F1.3. Superficially wild type. External left primer: TTTAACGGAATGAATTCGCC. External right primer: ACTAGCCTGGTGCCTTCTTG. Internal left primer: CAGGAAGAGGAGCTTTTGGA. Internal right primer: GTTCCATGCAACTACTGCGA. Internal WT amplicon: 3042 bp. Deletion size: 1595 bp. Deletion left flank: ATCAAAAATTAAGTCAATCGCTCATATTAA. Deletion right flank: TGTGGTAATTATAAAGGAATTCATGGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1419 D1054.3&D1054.5(ok1903) V/nT1 [qIs51] (IV;V). C. elegans D1054.3, D1054.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1903 homozygotes (Dpyish, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATGTTGGCATGAACGAGAA. External right primer: TGATCGTACACCACCTCCAC. Internal left primer: CGTTGAGGTGGCTGTTTGTA. Internal right primer: AGGAGGCATGCAGAAGACAT. Internal WT amplicon: 2105 bp. Deletion size: 1332 bp. Deletion left flank: TCAAGATTTTCTAGTGATCCTCCCAAGCAT. Deletion right flank: ACTCAATTGAAGATAATAGCTCTGATCACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC142 dgk-2(gk124) X. C. elegans F46H6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1420 pcn-1(ok1905) IV/nT1 [qIs51] (IV;V). C. elegans W03D2.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1905 homozygotes (thin, variable larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCCGTCTTGGACTCTGAAAA. External right primer: ATTTCCCCATTAAAAACCGC. Internal left primer: GTGGCGAAATCGTCATTTTT. Internal right primer: AAAATGCCTGGTACGCAATG. Internal WT amplicon: 2107 bp. Deletion size: 1169 bp. Deletion left flank: CACAGAGAGAGACGAACTCTGTCGGAAAGT. Deletion right flank: TTGGCCTCAAACATTTTGACGGGAGATCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1421 hmg-1.2(ok1906) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F47D12.4. Homozygous lethal deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1906 homozygotes (Dpy, larval arrest). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGACTCGCAACCCTCTTCT. External right primer: ATTGTCAACAGAGAACCGGC. Internal left primer: CTATTCGCGTGATCTTGTGC. Internal right primer: ACTTTGGGCTCTTCTGGTGA. Internal WT amplicon: 2101 bp. Deletion size: 759 bp. Deletion left flank: ATTCTGGTTACAGCGCAAACATTTTTCCCA. Deletion right flank: AAAAGAGCCCTGTAAGTTTTTTAAAGTTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1422 K07H8.10&K07H8.3(ok1907) IV/nT1 [qIs51] (IV;V). C. elegans K07H8.3, K07H8.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1907 homozygotes (Unc, late larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGAACTTATTGCCACCACGG. External right primer: ATCCTCCTGAAAGGGGAGAA. Internal left primer: CAGAGAAATCTCCTCGACCG. Internal right primer: CCAGTTGGAAAAGGCAAAAA. Internal WT amplicon: 2234 bp. Deletion size: 1757 bp. Deletion left flank: CCGCCACCACGTGGGGTGAAGCCACTGCCA. Deletion right flank: GAAGAACGGAACATCGAGCCAGCAGATCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1423 ucr-1(ok1909) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F56D2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1909 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAGCTACGCGCAGGATAAA. External right primer: TTGATGGGCAGACAATCTCA. Internal left primer: TAAACTTTCGGTGGGTCTCG. Internal right primer: TTTCTGGCACAATTCGTCAA. Internal WT amplicon: 2410 bp. Deletion size: 1548 bp. Deletion left flank: ACTCGCCGTCAGCTCTGCTTTGCGTCCGGC. Deletion right flank: AGAACCAATTCAGAACCAACTTGTACCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1424 ZK20.4&ZK20.3(ok1910)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans ZK20.3, ZK20.4. Homozygous lethal/sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1910 homozygotes (late larval arrest or sterile adult with no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGACTTGCATCGTCTCCAA. External right primer: AGAGCCTTCTCAACTGCGAC. Internal left primer: TGACAGGATTCTGGCCTTTT. Internal right primer: AGAAGATTTTTATGGGCGGC. Internal WT amplicon: 2172 bp. Deletion size: 1030 bp. Deletion left flank: AAATTTCTCACTTCGTAGCATCCAAATCTG. Deletion right flank: AATCTGGTTCTTGGTCAGCAGCATCATCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1426 cul-4(ok1911)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1911 homozygotes (mid- to late-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATGTTTCAACAAGCAGCGA. External right primer: AGTGGCACGGATAAGGATTG. Internal left primer: CACAACCGCAACAAATGAAC. Internal right primer: GATGAGTGATTCCAGGCGTT. Internal WT amplicon: 3035 bp. Deletion size: 918 bp. Deletion left flank: ATGAAGTACGTACACAATTCTCAAAGTATT. Deletion right flank: AATTAATTGCAACAATGTATCAAACTGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1428 Y32G9A.6(gk653) V. C. elegans Y32G9A.6. Superficially wild type. External left primer: AATACGGACGTTCTGGCAAC. External right primer: TGGCAGCTGCATAGTGAATC. Internal left primer: CCACCGAGTGTTCCTACGTT. Internal right primer: CATTTGGTTGGCTTGCTTCT. Internal WT amplicon: 1669 bp. Deletion size: 699 bp. Deletion left flank: TATCCCGACTACCTCAATTGTGTCCTTTGT. Deletion right flank: TGAAACACCTACATTATTCGCAGGTAGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC143 elt-3(gk121) X. C. elegans K02B9.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1431 K06A5.4(ok1924) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K06A5.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1924 homozygotes (Dpy, larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGCAAAATCGTAGGAACAA. External right primer: TTCAACGCCTTCTGAGTTCC. Internal left primer: GCCTAATGGGTGATACGGAA. Internal right primer: TCCTTTGCCTTCGTTTGTTC. Internal WT amplicon: 2805 bp. Deletion size: 2034 bp. Deletion left flank: GCTGAAGCTGAGGCTGAAAGAAGGCGAAAA. Deletion right flank: ATTAGTTTTAAAAAAGCATTAATTTTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1432 srh-159(ok1928) V. C. elegans F40D4.3. Superficially wild type. External left primer: CAAGCAGAATACACTGCGGA. External right primer: GGCAAATGTAGGACTGGCAT. Internal left primer: AAGTCCGATACGGGACTGTG. Internal right primer: CGGATGCCTTTTGTAGGTGT. Internal WT amplicon: 2230 bp. Deletion size: 954 bp. Deletion left flank: GTGATAGCTGCTACACAAAATGCACCTGCT. Deletion right flank: CAAAAGTACACCCATTTCTAGAAGCACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1433 unc-25(ok1901) III. C. elegans Y37D8A.23. Superficially wild type. External left primer: GCTTCAACATTCCAACCGAT. External right primer: TTTGCCACCGAACTCTCTTT. Internal left primer: GGCTCAACTGTCTACGGAGC. Internal right primer: TTTTGAGAAGGGGAGGAAGG. Internal WT amplicon: 3008 bp. Estimated deletion size: 1700. Breakpoints only narrowed due to poor sequence quality. Deletion of approximately 1700 bp lies between chromosome III coordinates 12948249 and 12950465. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1434 +/szT1 [lon-2(e678)] I; sdha-1(ok1908)/szT1 X. C. elegans C03G5.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1908 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACGAAGGCAAACTGGTGAC. External right primer: CTACGAGCGGTTCATTTGGT. Internal left primer: AATAGGAGCGGACCTTTGGT. Internal right primer: GCAATTCCGCACGTTTATCT. Internal WT amplicon: 2954 bp. Deletion size: 1211 bp. Deletion left flank: GACGAAGCTCGGCAGTTGAGATGTCTCCCT. Deletion right flank: GCATTACAATTAAAATATTCTGATTAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1437 K09H11.3(ok1889) V. C. elegans K09H11.3. Superficially wild type. External left primer: TTTAAGATTCGCCAGCCTGT. External right primer: GACCTCAGCGCATTTGTGTA. Internal left primer: GTCGTTACATCCTCGTCGGT. Internal right primer: TTCCTCGATGCTCTTCGTTT. Internal WT amplicon: 3077 bp. Deletion size: 1648 bp. Deletion left flank: TACGACTGGACACACTGCCGAGCCATCCAA. Deletion right flank: TGCCAAAGAAAATGAACCGATCGGGAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1438 dnj-13&F43D5.7(ok1925)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F54D5.8, F54D5.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1925 homozygotes (sterile, lays eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CTCTGGAAAGTTCCGCACTC. External right primer: TTTGGAGGGTGAGCTCAAGT. Internal left primer: TTCCATTTCTCCGTGTTTCC. Internal right primer: AGGTGATTGTTGCGGTTTTT. Internal WT amplicon: 2104 bp. Deletion size: 1109 bp. Deletion left flank: AGATGAAGATTACAAGAAAAGTTATGACGG. Deletion right flank: TTAATATTTAAGGCTGGTGTAGTCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1439 skr-2(ok1938) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F46A9.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1938 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAAGCCAAATTGAATGGTT. External right primer: TTCCTTCTTCGTCGTCGAGT. Internal left primer: CGCGACATAAAAATGCACAC. Internal right primer: CACACAAAGGAAGAGACGCA. Internal WT amplicon: 2146 bp. Deletion size: 1107 bp. Deletion left flank: GGTGCACCAAACACCAGTCCGACCCAATTC. Deletion right flank: GTTCTATAACGATCGATAACTCTGCGTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC144 elt-3(gk122) X. C. elegans K02B9.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1440 ran-2(ok1939) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C29E4.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1939 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGCAGAATCACTGAAAACG. External right primer: CCCAATCAGTTTCAGCCTGT. Internal left primer: GCTCTTGGAGAGGCATTGAC. Internal right primer: CGGCGGACGATATTTTCTTA. Internal WT amplicon: 2901 bp. Deletion size: 2075 bp. Deletion left flank: GACAAAATAAATCGAGATTGTCTGAAGAAA. Deletion right flank: ACGTGTTATTCTTCAACTTTCAGCACCTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1441 ceh-6(gk665) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K02B12.1. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk665 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGACAGACGAATGCAACGA. External right primer: GTGCCTTCTTTTTCCAACCA. Internal left primer: ACAGAAGAAAGGGCGGAAAT. Internal right primer: CAACTTCCAACTGCTTTGGG. Internal WT amplicon: 2295 bp. Deletion size: 1525 bp. Deletion left flank: GAAGGTACATTAGTGAATAGGAAAATAATA. Deletion right flank: AGACATTGATGCTGTAGAATTGTGAAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1442 grd-2(ok1902) V. C. elegans F46B3.5. Superficially wild type. [NOTE: This strain apparently carries a patrially penetrant or heterozygous Rol in the background. It is present in the original stock received at the CGC.] External left primer: TGTCGAGTGCACAAGAAAGG. External right primer: CCGCAAAGTTTCTTAGCCTG. Internal left primer: CCGTGCAGGTAACCATCTTT. Internal right primer: TCCATGATCAAAACACACCG. Internal WT amplicon: 3162 bp. Deletion size: 1293 bp. Deletion left flank: GATTTTGCTTCCAGTATCCAATTCATCAAC. Deletion right flank: ATGTTGGCCTCCTGTTATAGTGAAGTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1444 unc-42(gk598) V. C. elegans F58E6.10. External left primer: AAAGCGAAGCTCCTCCCTAC. External right primer: CCATCGAGGCAGTTCAAAAT. Internal left primer: GATCCGAAATTGGACGAAGA. Internal right primer: AAGGACGACGTCTGACAACC. Internal WT amplicon: 2097 bp. Deletion size: 1430 bp. Deletion left flank: TTTAGGATTGAACACACCAAGATCAGATCT. Deletion right flank: GTTAACGAAGAAATGTTTCCTAATTTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1445 nhr-202(gk663) V. C. elegans M02H5.4. External left primer: CTCTCGCCGAGCTATTTTTG. External right primer: TCAAGTATTTGCCCGTCACA. Internal left primer: GTTGAACCTTGCGCTGAAAT. Internal right primer: TCCAATTTGAATCGATGCTG. Internal WT amplicon: 2294 bp. Deletion size: 995 bp. Deletion left flank: TCGAGCTTGTGCGGTGTTTTTCAGGTAAAT. Deletion right flank: GGTATTACAAATGGAAAATGATCTAGTGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1447 let-60(ok1932) IV/nT1 [qIs51] (IV;V). C. elegans ZK792.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1932 homozygotes (late larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAATACGAGGGAGCAAAAA. External right primer: ACTCATTCCGACTCACCACC. Internal left primer: AAATGAGTTGGCGAAATTGG. Internal right primer: CCCACAGAAATCCTTCTCCA. Internal WT amplicon: 2164 bp. Deletion size: 992 bp. Deletion left flank: CCTTAATTGTACATTAAAAACATTATTTTT. Deletion right flank: TTCGTCTTTGGAATCAATTAAACAGCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC145 pes-7(gk123) I. C. elegans F09C3.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1450 ubxn-2(ok1942) IV/nT1 [qIs51] (IV;V). C. elegans Y94H6A.9. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1942 homozygotes (grotty sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATTTGAGAGGTTTTGGGGG. External right primer: ATTTTGCAACGATTTTTGGC. Internal left primer: TCAATTTTCAATTTTCCCGC. Internal right primer: ATTTCAAAGTGAACCGCCAC. Internal WT amplicon: 2627 bp. Deletion size: 2239 bp. Deletion left flank: GCGGGCGCTGGAAAATCAAAATTTTTAAAT. Deletion right flank: GCAGTATGATCCGGGTTATGATCAGTTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1451 sptl-3(gk662) V/nT1 [qIs51] (IV;V). C. elegans T22G5.5. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk662 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTTCTCCGTCTCGTCATTG. External right primer: ATTGAGTTCGTGGCAAATCC. Internal left primer: CTTGGTGTCCCTTTCGTGTT. Internal right primer: GTGTGCAACGTGGTTACCTG. Internal WT amplicon: 1706 bp. Deletion size: 1080 bp. Deletion left flank: TGGGTGTCTTCTCTCTAAATACAATTGATT. Deletion right flank: ATCTCGGCTTCTCGCATCGATCTGGAGTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1452 mab-23(gk664) V. C. elegans C32C4.5. Superficially wild type. External left primer: GAACATTTGGTTGCAGCAGA. External right primer: AAGCACGGAGACGAGAAAAA. Internal left primer: CGCCTGACATCCGATCTATT. Internal right primer: TGCCATTGATGTTGCAGTTT. Internal WT amplicon: 2340 bp. Deletion size: 586 bp. Deletion left flank: AAGAAGGGACACAAACAGAAATGTCCATAC. Deletion right flank: TCGGCATCTTTTTTCATACATGAACAGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1453 unc-4(gk668) II. C. elegans F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 1602 bp. Deletion left flank: CGTTTCCGATCCATCGGATGGATTCAGGAG. Deletion right flank: AACTGGGAAATTGGATTTAAAAATTGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1454 nhr-267(gk667) IV. C. elegans H22D14.1. External left primer: TGGGTTTTTAACGGGACGTA. External right primer: TTTTCCCTCACCTCATCCAG. Internal left primer: CGTTGCCATACATTCGAAGA. Internal right primer: CGTCTGCCTTCCAACTTTCT. Internal WT amplicon: 2278 bp. Deletion size: 499 bp. Deletion left flank: TTCATTCATTGATTCAGCAAGTAGGGCATT. Deletion right flank: TACTTACAATCTTTGGACATTCCTGCTCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1455 K03C7.3(gk671) X. C. elegans K03C7.3. External left primer: AACGATTCGATTCATCCTGC. External right primer: AACACAAACACCCCGATCAT. Internal left primer: GCGGCAAAGGCATTTATTTA. Internal right primer: CTAAGAACGTTCGTCGCGTT. Internal WT amplicon: 1979 bp. Deletion size: 513 bp. Deletion left flank: CCATCGTCTTCTTCTTCGTTTTTCTACTTT. Deletion right flank: CGCATAATTCGCTATTAATTCAAACTTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1456 nhr-98(gk651) V. C. elegans M02H5.6. External left primer: AGATCTCCAACCAACCAACG. External right primer: GACCCGCAATTTTCACAGTT. Internal left primer: TGCCAATTATGCTTCCATCA. Internal right primer: CATGACCATGTCATCCTTGC. Internal WT amplicon: 2395 bp. Deletion size: 665 bp. Deletion left flank: GTAATTTTTTCAGAAATGGATTCCCCTGGC. Deletion right flank: CAGAAACCCCGTATCAAGTTTCCAATGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1457 nhr-220(gk672) V. C. elegans T19H12.8. External left primer: CCTGGATTCGATTTTCGGTA. External right primer: GGCATCAGAAATGCTCCAAT. Internal left primer: AATAATGGCATCGGTTCTGG. Internal right primer: TCCAACCAAATGAGAGTCCC. Internal WT amplicon: 2272 bp. Deletion size: 754 bp. Deletion left flank: TTTTTGTCTCATCGTCAGAATTTCGAAATG. Deletion right flank: TTATATAATTTTTTTTATTGCAAAAATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1458 dyrb-1&dnj-23(ok1931)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans T24H10.6, T24H10.3. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1931 homozygotes (Sma, Unc, Gro with tail and vulval defects). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGGCGATTATGGAAGAGGAG. External right primer: ATTGCGATGAGAAAGCTCGT. Internal left primer: ATTCTCGCAAAGGCGACTAA. Internal right primer: CAAGCGTAAGGCTGAGAAGG. Internal WT amplicon: 2301 bp. Deletion size: 1608 bp. Deletion left flank: AGTTAGTAGGAACCAAGTTTGGCGAATACG. Deletion right flank: AAAACTTATAAATAAAGTGACAGATTTTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1459 npp-15(ok1954) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C29E4.4. Homozygous lethal deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1954 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGGCTTCCAATTTGACATCG. External right primer: CCACTCGACTTCCACCTTGT. Internal left primer: CATTCATCTTTCGCTGGGTT. Internal right primer: GTCTGCTGGCTTTCCAAGAG. Internal WT amplicon: 3083 bp. Deletion size: 1597 bp. Deletion left flank: ATACCCGGCACTGGTGAAAGAGGCCTTTCT. Deletion right flank: ATGGCAGAGTCGGAAGAGGAATTAAAGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC146 cln-3.3(gk118) V. C. elegans ZC190.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1462 max-2(ok1904) II. C. elegans Y38F1A.10. Superficially wild type. External left primer: GGCACCGTTGTTTTAGATGC. External right primer: GAATGCAGATTTTTGCACGA. Internal left primer: CCCGTTTTGAGCAATCAAGT. Internal right primer: CTCTGCGTGTCAAAAATCCA. Internal WT amplicon: 3024 bp. Deletion size: 2220 bp. Deletion left flank: TTGAAAGTGTGGTGGGTGGGCGGAGATTCC. Deletion right flank: AAAGCTTTTCACGATGAGATGCTCGAACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1463 gon-2(ok465) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01H8.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok465 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAGAGGTTAAATCAGCCCG. External right primer: GTTGCTGCATTTGGACTTGA. Internal left primer: TGGTGAATAATTGGCTGCAA. Internal right primer: GATGCTTTGGGTTTGTGCTT. Internal WT amplicon: 2829 bp. Deletion size: 507 bp. Deletion left flank: TAATGGTAATCTGACAGAAAACGATTTTTT. Deletion right flank: AGAACTAGAGATATTTTTTGATAAAAACGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1464 F21A10.2(gk669) X. C. elegans F21A10.2. External left primer: ACCCGAACAATAACACGCTC. External right primer: GGCCATTTCTCCGTCATTTA. Internal left primer: CATCAGTGGCAGTTGCGTAT. Internal right primer: CGCGAGAAAGAAAGAATTGC. Internal WT amplicon: 2333 bp. Deletion size: 996 bp. Deletion left flank: CATAAAAATGTTTTCAAGCACTTCAGATAT. Deletion right flank: CACGCGGGCACCCTTGCCTGACTGGGGGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1466 xpa-1&K07G5.3(gk674) I. C. elegans K07G5.2, K07G5.3. External left primer: AATTTTCAGGCGAAGAAGCA. External right primer: TTCCACGTGTTCTTTCCACA. Internal left primer: GGTTTGATGGACAGTTGGCT. Internal right primer: ACCTTCAGACGTTTGCGACT. Internal WT amplicon: 1659 bp. Deletion size: 560 bp. Deletion left flank: CGTGGAAGAGGACACATGGAGAAGAACATG. Deletion right flank: AAGAACATTTGATGAAATTTAAAGCAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1467 nhr-21(gk730) II. C. elegans F21D12.1. External left primer: CTCTTCTCAGCTCCACCCAC. External right primer: ACCGAGATGCACTTTTTGCT. Internal left primer: ACGCTCTCCGTCTAATCCAA. Internal right primer: ATCACGTGCCTCATTGAGAA. Internal WT amplicon: 2296 bp. Deletion size: 1523 bp. Deletion left flank: AACAATGCGTTTAATGTCAAAAGATTCATC. Deletion right flank: AGTAAACTTTTGTAATGGGTGTTTAAGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC147 apc-10&tag-314(gk143) V. C. elegans F15H10.3, F15H10.4. Superficially wild type, with small broods of viable progeny and lots of unfertilized oocytes. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1470 nhr-126&nhr-134(gk731) V. C. elegans F44C8.2, F44C8.10. External left primer: AAATGCCGAATTACTCGTCG. External right primer: TCAAAAACGCAGCAGACATC. Internal left primer: GCAGATTTGAGATTGCGGAT. Internal right primer: CAGAAGCGATTCTTCTTGCC. Internal WT amplicon: 1783 bp. Deletion size: 1478 bp. Deletion left flank: AAGTTGATTTTTCCCACCCTGAGATGTATG. Deletion right flank: GTAGATGTGGCAAGGGATATTCTGAAAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1471 nhr-186(gk732) V. C. elegans F47C10.3. External left primer: GAGGTCAATACAACGCCGAT. External right primer: TGTCCATTCGCAATTTTTGA. Internal left primer: ATATTTGCGACCGGCATTTA. Internal right primer: AAGCCTTGCCTATTTCCGAT. Internal WT amplicon: 2226 bp. Deletion size: 2034 bp. Deletion left flank: CGATATCGGCATGCTCGGCATCGCGTGGAG. Deletion right flank: TGAAAAAAAAAACAGAGAACTGTAAATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1472 nhr-143(gk677) V. C. elegans F59E11.11. External left primer: CGGAATATCCAAAAGGCTGA. External right primer: GGAAAAATCATTCAAGGCGA. Internal left primer: CGAAACCACAAATTGCTGAA. Internal right primer: CCATATGCATTGCGACTGAG. Internal WT amplicon: 2168 bp. Deletion size: 672 bp. Deletion left flank: CTTTTTTTCGAAACAAAATTAGATGAGGAA. Deletion right flank: AGAATAATGAACAAAACACAAAATTCTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1474 K12D12.1(ok1930)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans K12D12.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1930 homozygotes (sterile Unc with withered tail, often grotty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCAATCAAAGGATTCGAGG. External right primer: ATGTCCTGGCCTTCCTTTTT. Internal left primer: GAACCCCTCAAGATCGCATA. Internal right primer: GGCTCCTTTGGCTCTTTCTT. Internal WT amplicon: 3358 bp. Deletion size: 1788 bp. Deletion left flank: TAGTGACGCTGGAGAAAGTTTTTATCCAGT. Deletion right flank: AGCTCCATGGTACAAGAACTTCCGCGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1475 tbx-9(gk666) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T07C3.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk666 homozygotes (sterile). Viable fertile non-GFP progeny are recombinants and not homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCAGCGACCACTATGAC. External right primer: CAGAATCGATAGCCGAGAGG. Internal left primer: AATTTAATCGGCGGGTCTTC. Internal right primer: TTTGGCAATGAGGTGAGATG. Internal WT amplicon: 2334 bp. Deletion size: 892 bp. Deletion left flank: AGCGTTGTTGGACTCTGAATAGTTGGAGAT. Deletion right flank: GGAGGAGCGGGAAAACTATTCTAACTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1476 F47B7.5(ok1950) X. C. elegans F47B7.5. Superficially wild type. External left primer: TCCGGAGCCATTGTAATCTC. External right primer: TTCAGGCATGCAAGTTATGC. Internal left primer: ATCAAACCGAAATGGGACAG. Internal right primer: CGAAGATGACACGATGGATG. Internal WT amplicon: 2546 bp. Deletion size: 1375 bp. Deletion left flank: AGCCTGACACCACGTATGTAGTTGGAATAA. Deletion right flank: TTGCGAGTGTTGTCATTATCGTTATCTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1477 mab-5(gk670) III. C. elegans C08C3.3. External left primer: TACTGGTTGCGAGATTGCTG. External right primer: TTCATGCTCCTCCCAATTTC. Internal left primer: GTTCCTGTCTTCAAGGCGAC. Internal right primer: ATTCACACGTTGTTCGCATC. Internal WT amplicon: 2178 bp. Deletion size: 920 bp. Deletion left flank: AAAAACCTGTGAGAAATTTACAACAATTGA. Deletion right flank: TGCTCATTTGCCGACGGATTGAGTTGAGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1478 vpr-1(tm1411) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F33D11.11. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1411 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCCGAGATAATACGGCGA. External right primer: ACGCTTGCCTCTAGGCACTA. Internal left primer: TTGGGGGAACGGGGAACCAT. Internal right primer: TAGGCACTAAGCACTGGCCA. Internal WT amplicon: 1799 bp. Deletion size: 657 bp. Deletion left flank: CCTCGTTCCTAACCGCAAAGGTTTTTGTAT. Deletion right flank: TGTTTTTTTTCTATTGGTATTTACGTACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC148 zhit-3 tftc-3(gk144)/mIs10 V. C. elegans ZK856.9, ZK856.13. mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs10 homozygotes), and non-GFP sterile Uncs with a vulval blip (gk144 homozygotes). mIs10 suppresses recombination from unc-60 to about dpy-11 on LG V, and does not balance gk144 perfectly, but this strain is not difficult to keep. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1480 srh-215(gk673) V/nT1 [qIs51] (IV;V). C. elegans T20B3.3. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk673 homozygotes (sterile adult, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGACGATCAGGAATGGGA. External right primer: AAAGCGGAAAGTGGGAAAGT. Internal left primer: GCCAAGAACCAAACTTCCAA. Internal right primer: CGATTTCCACGTACTGAGCA. Internal WT amplicon: 2225 bp. Deletion size: 958 bp. Deletion left flank: TAAGAATCTGACTTTCATTTCGGCTTGCAA. Deletion right flank: GCCCGTTTTGGCAATGATAATTGCTTTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1481 ceh-6(gk679) I. C. elegans K02B12. External left primer: GAGACAGACGAATGCAACGA. External right primer: GTGCCTTCTTTTTCCAACCA. Internal left primer: ACAGAAGAAAGGGCGGAAAT. Internal right primer: CAACTTCCAACTGCTTTGGG. Internal WT amplicon: 2295 bp. Deletion size: 508 bp. Deletion left flank: AGCGGTCTTTCTGCGTCTCGTCTAGCCACC. Deletion right flank: GTTACGTATTGACAACCTGGTGAAAAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1482 taf-11.2(gk682) I. C. elegans K10D3.3. External left primer: GTCAACTGATATGAGCGGCA. External right primer: CGCGTAATCTTTTTCTTCGC. Internal left primer: GAACATGGCCCTGAAATGAT. Internal right primer: GGCGCTATTCAGCTTTCAAT. Internal WT amplicon: 2230 bp. Deletion size: 1887 bp. Deletion left flank: TGACTGATAATTTTTTAAAAACCCGAATAA. Deletion right flank: GAGAAATCGTTGACGGACAGGGAACTAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1484 K09B11.2(ok1967) IV/nT1 [qIs51] (IV;V). C. elegans K09B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1967 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAACTAACGGCTTTGC. External right primer: TTGCTCGATTCACACGAAAC. Internal left primer: TGGAGGAATTGTTGCAGTGA. Internal right primer: CCGGAAGGTTGTAGTCGTTG. Internal WT amplicon: 4083 bp. Deletion size: 1709. Deletion left flank: TTAGCTGGAGCGAATAACGATCGGAAAGTT. Deletion right flank: AAATATAACATTTTACAGTTTTCGTTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1485 odc-1(ok1969) V/nT1 [qIs51] (IV;V). C. elegans K11C4.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1969 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTTTTGATCCACTCGTGA. External right primer: CGCTACACCACATCATCACC. Internal left primer: TTTCATTCTTCATGGAGCCC. Internal right primer: CTCTCCAAAGTTGACTCCGC. Internal WT amplicon: 2148 bp. Deletion size: 1529 bp. Deletion left flank: CTCCCACATTTCCTCGCTCATCACATACAT. Deletion right flank: TGTAAGATCAAAACGCTGCTAGCAAACTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1486 T07C5(gk614) X. C. elegans T07C5. External left primer: AAACCACTCACCAGGATTGC. External right primer: TATATTGCTCTGCGCGAATG. Internal left primer: TGTATCCGGCTGCATATTGA. Internal right primer: CCTTCACGATTTGTCGCTTT. Internal WT amplicon: 2177 bp. Deletion size: 560 bp. Deletion left flank: CAGATTTGAAACGTTAAACACTACAATCCA. Deletion right flank: TTTCAAAATCACAATTCCAAAATCATTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1487 C02H7.1(gk675) X. C. elegans C02H7.1. External left primer: GTGGTCTCCATGACAACGTG. External right primer: CTTTTTCAGTTTTGGAGGCG. Internal left primer: TCTTGCGTGTATTACCGCTG. Internal right primer: CTACCACCTCCAGCACCAGT. Internal WT amplicon: 1961 bp. Deletion size: 932 bp. Deletion left flank: GGTCAGCGCATAAATTTTCGCTAAATTTTC. Deletion right flank: CAAAAAGAGCAAAAAAGACCCGAGTGAACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1489 F31A9(gk683) X. C. elegans F31A9. External left primer: AGTTCCAATCCCTGCAACAC. External right primer: AGGTCCGGTACCTGTGACTG. Internal left primer: AGAACTTTGAGCGGCCATAA. Internal right primer: TCCTGTTCACGGAAACACAG. Internal WT amplicon: 1716 bp. Deletion size: 525 bp. Deletion left flank: TTAGGTTCAAAAAACAAACTCTCAAATTTC. Deletion right flank: AAAGATGTCTGGCTTCTCGTTTTTCATCAC. Insertion Sequence: ATTAAAGAGACATCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1491 Y40H7A.10(ok1968) IV. C. elegans Y40H7A.10. Superficially wild type. External left primer: CAACGGCAGTTCCATTTTCT. External right primer: TGAAAATTTCGGACAGGAGG. Internal left primer: TGAAGCGAACAACAAATTGC. Internal right primer: GGGCGCTATAGAAGTTGCAC. Internal WT amplicon: 2703 bp. Deletion size: 1128 bp. Deletion left flank: ACTGGGAAAAAACTTTGCATTTTTAAAAAC. Deletion right flank: AAATAATTTATGCTTGAGAACTGTTCGTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1494 npp-5(ok1966) II. C. elegans F07A11.3. Superficially wild type. External left primer: TCACGTGAAACCCACAGAAA. External right primer: CTTCCAACTCCTTCGACGAC. Internal left primer: TGTCTGTGAAAGATCGACCG. Internal right primer: CGATATTCCTCAAGGGCAAA. Internal WT amplicon: 2771 bp. Deletion size: 1291 bp. Deletion left flank: AGCCCAAGTTTCAGAGCAATAGTGATCATG. Deletion right flank: TGTCATCTGGTAGTACTTTGCGCGTCGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1495 C50H2.6(gk681) V. C. elegans C50H2.6. External left primer: ATCTCCCCGGTTTCCATATC. External right primer: ATATGACTAGCACGGCAGGG. Internal left primer: TTTCTTGCCTCCCTCTTGAA. Internal right primer: AGTCACTCACGGGCAAAGAT. Internal WT amplicon: 2224 bp. Deletion size: 341 bp. Deletion left flank: AGACACGACTCAATGAAGATGAGCAGCAAA. Deletion right flank: TCGGCTCGTACGAGGCTGAATAACAGAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1496 nhr-130(gk684) V. C. elegans T01G6.8. External left primer: TTCGGATACTTTTCGGTTGC. External right primer: TTCCATTTTTACGGTCCTCG. Internal left primer: GATATGAGGTCCCGATCGAA. Internal right primer: TGAGGCAGATTGGTGTTCTG. Internal WT amplicon: 2444 bp. Deletion size: 834 bp. Deletion left flank: CCCGCAAGTTTTATCTCAAAATTTTGAATT. Deletion right flank: CGAAAAAATCGTAATAAAACGATTTTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1497 fum-1(ok1998) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans H14A12.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP ok1998 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: ACTTGTGCGGGAGAAGAGAA. External right primer: CGAATTAAGCTTTCAAGGCG. Internal left primer: GAACCATGCCGAGTTTGATT. Internal right primer: TGAACATTTGGGGACATTGA. Internal WT amplicon: 2152 bp. Deletion size: 1351 bp. Deletion left flank: ACTTTCGGAGAGCTCGAGGTTCCAGCCGAC. Deletion right flank: TGCTCACAAGAACGGCACCACCCTTGTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1498 cap-2(ok1929)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans M106.5. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes) and non-GFP ok1929 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTTGTTCTTTTTGCACGCTG. External right primer: AGGGAACTGATGTTCCGATG. Internal left primer: CGGGAGCCAATTTACAGAAA. Internal right primer: GAACGAAAATGGTCCAGGAA. Internal WT amplicon: 2129 bp. Deletion size: 1084 bp. Deletion left flank: AAAACAAAAATTTGAAGAACTCTGGCGAAA. Deletion right flank: CTGCAGACAAACAAAAGCTCCAGCGGTGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1499 nhr-117(gk707) V. C. elegans F16B4.12. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 349 bp. Deletion left flank: TTTGCCGCTGCACACATGTATGTTTGAAAA. Deletion right flank: AAAATCCTCTGATCGGTTTCGTCTAGCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC15 haf-8(gk12) IV. C. elegans Y57G11C.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC150 tag-10(ok246) II. C. elegans C31C9.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1501 F34D6.2(gk695) II. C. elegans F34D6.2. External left primer: TCCTGTCAACCCTCAGCTCT. External right primer: ATAATGCATTGCAGAGCACG. Internal left primer: ATGGTTCACACGGTTTCTGG. Internal right primer: ACACAACGAGAGCCCATTTC. Internal WT amplicon: 2355 bp. Deletion size: 1929 bp. Deletion left flank: TTTGCACCCCTTTGCTCAACTTTGACAGCT. Deletion right flank: TTTCAAAAAATCTTAAAATATTACCATATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1502 taf-7.1(gk696) X. C. elegans F54F7.1. External left primer: GTCAGCCGAATCAAAAGCTC. External right primer: TTTCCTTCCTCTCCCGATTT. Internal left primer: CCACTCTGTTGCCAATTTGA. Internal right primer: GGACGAAGAGCGTCCAAATA. Internal WT amplicon: 2248 bp. Deletion size: 1772 bp. Deletion left flank: AGTTCATTTGTTTGTTTATTTGTTTCGTTT. Deletion right flank: TACATTAAAATTGAAAATGGGAAACTAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1503 egl-46(gk692) V. C. elegans K11G9.4. External left primer: GGACATTTGTGTTGTGCCAG. External right primer: ACAATTTGGGCGATTGAAAG. Internal left primer: ACAGCCGGCAGATACAGTCT. Internal right primer: GGTGGAATAAACGTCCGCTA. Internal WT amplicon: 2234 bp. Deletion size: 1144 bp. Deletion left flank: GCCGATAGCTTTACTCACCTTTATGAACAT. Deletion right flank: TTTTATTGGCATTTGAAAAGTGGCAATTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1504 Y58G8A.2(gk697) V. C. elegans Y58G8A.2. External left primer: GGGCCAGTTGGTCAGAGATA. External right primer: GGGAAGTGATTCGTTCTCCA. Internal left primer: TGCACTCAAGATCAAACGGA. Internal right primer: CTAGACTGGGCGGCATTTAG. Internal WT amplicon: 2306 bp. Deletion size: 1295 bp. Deletion left flank: TTTGGAGCTTTTTTGAACTTTCTTAAAAGT. Deletion right flank: GGAAAGTTTGTAACAGATACATCTGTGCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1505 npp-3(ok1999)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans K12D12.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1999 homozygotes (early- to mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTTGCCAGTGTCAATCAGC. External right primer: TCGCTCTCCACTTCTCCAGT. Internal left primer: CCCCAGAACCACAAGACACT. Internal right primer: TCGATGCTTGATTTGCTGAC. Internal WT amplicon: 3383 bp. Deletion size: 1321 bp. Deletion left flank: GTAACCAACAATCATACGACGAACAGCGAA. Deletion right flank: ATTCGATATATTTGAGGCCTGAAACTCACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1506 gpb-1(ok1875)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F13D12.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1875 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTGATGTGGGGGTTTTAGGA. External right primer: ATCGCGTCGCTCACTAGAAT. Internal left primer: ATCGGGGAGAGAAAGAGAGC. Internal right primer: GGGGCACTATTGCATCATCT. Internal WT amplicon: 2980 bp. Deletion size: 1978 bp. Deletion left flank: GTAGAATACGATCGGGGAGAGAAAGAGAGC. Deletion right flank: ACGAGACACCCGCACGTTTCCCTCGCGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1507 kbp-4&par-2(ok1890)/sC1 [dpy-1(s2170)] III. C. elegans Y92C3B.1, F58B6.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1890 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACCCCTCACCTCGACTT. External right primer: AAAAATTGGAAAAATCCGGG. Internal left primer: CGAAGGGAAAATGCAGGATA. Internal right primer: TAAAAATCGGCAGAAATCGG. Internal WT amplicon: 2138 bp. Deletion size: 898 bp. Deletion left flank: AGGATAATTTTTTTTTTGTTGGGAAATTTA. Deletion right flank: TACGGGCTTCGCAGAGCGATTTATCGATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1508 +/szT1 [lon-2(e678)] I; sulp-3(ok1953)/szT1 X. C. elegans F41D9.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1953 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCGTAAGGGTAATTGGCA. External right primer: TCCAAGAAGGAGTGGTCCAG. Internal left primer: TTCATCAACAGCAGTTTGGC. Internal right primer: CAACGTGCATATCCCAACAG. Internal WT amplicon: 3086 bp. Deletion size: 2464 bp. Deletion left flank: GTTTCTGACATGACCTCTTCAGAATTTTCA. Deletion right flank: GAGGAAATCTGTTGATTAAATAATGAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1509 nhr-220(gk690) V. C. elegans T19H12.8. External left primer: CCTGGATTCGATTTTCGGTA. External right primer: GGCATCAGAAATGCTCCAAT. Internal left primer: AATAATGGCATCGGTTCTGG. Internal right primer: TCCAACCAAATGAGAGTCCC. Internal WT amplicon: 2272 bp. Deletion size: 672 bp. Deletion left flank: CCATTGGGGAAATTGCTTCAAACCCCGCAT. Deletion right flank: TTGTATTTTTTTCTCAAAGGTCTATAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1511 F32H5.1(ok2017) V/nT1 [qIs51] (IV;V). C. elegans F32H5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2017 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTGACAGAGACTTCGG. External right primer: GAGTTCGCGGAAATTTATGG. Internal left primer: CTAGACGGCGATACCTGGAA. Internal right primer: TTTCCAACATCCCTGGAGAG. Internal WT amplicon: 2266 bp. Deletion size: 1489 bp. Deletion left flank: ATCGTAAGAAATCATACCATTCTCTCCAAA. Deletion right flank: GTTTCCGCTTTCCATAGTTTCTGTTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1512 H01G02.2(gk687) IV/nT1 [qIs51] (IV;V). C. elegans H01G02.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk687 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTGCATGGAAAGGCAAAAAT. External right primer: TCGCTACAGGGGAGAAAAGA. Internal left primer: GTTCGGTCTTTGGTCGTGTT. Internal right primer: CGGAAACCATTTGAGGCTAC. Internal WT amplicon: 1834 bp. Deletion size: 449 bp. Deletion left flank: TGAAGCTATTCAGAACAATTCAATTTTTAT. Deletion right flank: GAAGAAGATTAAAGTGTGAATGTGTACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1513 +/szT1 [lon-2(e678)] I; adt-1(ok1965)/szT1 X. C. elegans C02B4.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1965 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATACGACGACCTCAGTTGCC. External right primer: GCACAACTTTTGTCGGGTTT. Internal left primer: GTGTGACCCGTTATTCGCTT. Internal right primer: GCTCAGGACAACTTGCTTCC. Internal WT amplicon: 3370 bp. Deletion size: 1659 bp. Deletion left flank: TGATGCTTCCCCAGGCCTTATATCTACAAA. Deletion right flank: ATGGGGCGATTGGCTGCCGTGCTCTGTATC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1514 T23G5.3(ok2019) III. C. elegans T23G5.3. Superficially wild type. External left primer: TCTTGTGCAAGTTCGAAACG. External right primer: AATTGAAAAGGGTGTGCGTC. Internal left primer: GTACATCTTCCTTTCGCCCA. Internal right primer: TAACCTTCCCCAAGATTCCC. Internal WT amplicon: 2170 bp. Deletion size: 683 bp. Deletion left flank: TTAATTTTATAATTCTATAGATATTCTACT. Deletion right flank: TCAAATTTTCCCAATCTACCGTAACCCCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1516 Y58G8A(gk1021) V. C. elegans Y58G8A. External left primer: GGGCCAGTTGGTCAGAGATA. External right primer: GGGAAGTGATTCGTTCTCCA. Internal left primer: TGCACTCAAGATCAAACGGA. Internal right primer: CTAGACTGGGCGGCATTTAG. Internal WT amplicon: 2306 bp. Deletion size: 125 bp. Deletion left flank: ATTCAACAAGGGAAATGGGGGCTGGGTAAA. Deletion right flank: CTTTGAAGAGACACAGGTGTGAGTTTGCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1517 nhr-215(gk711) X. C. elegans T07C5.4. External left primer: TTGCTCAAAAGAAGCGGAAT. External right primer: TGGTTATGCGTCCAGTGAGA. Internal left primer: ACAAGCCTAATCTGCATGGG. Internal right primer: TGTGACGTCTGCAACAATCC. Internal WT amplicon: 2331 bp. Deletion size: 1279 bp. Deletion left flank: GATAAAATCATACTAAGCTGTCTGAAGACA. Deletion right flank: AAACAATCAACGAAAAATTAGAGTTCGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1518 atf-7(gk715) III. C. elegans C07G2.2. External left primer: CAAGAAGGGACGGAAATTCA. External right primer: AATATTTGCAGGTGGTTCGC. Internal left primer: GCTGTGGAGCTCGAAGAGTT. Internal right primer: CCACTGTTTCTCCACCCATT. Internal WT amplicon: 1805 bp. Deletion size: 1197 bp. Deletion left flank: ATTCCTCTAGTATTCCATAAATCTTGACAT. Deletion right flank: AGAAAAACAAACAAAAAGCTTACCTCTGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1519 gei-8(gk693) III. C. elegans C14B9.6. External left primer: CCCTCTCATTGTTCGTTCGT. External right primer: TTTTCGGGCAACAACTTTTC. Internal left primer: ATTTCATTGCGTGCATGTGT. Internal right primer: TAACTGTCAGCGTCTCGTCG. Internal WT amplicon: 1595 bp. Deletion size: 1018 bp. Deletion left flank: CGCCAATGACAACGAAGAAAATAAACTGAA. Deletion right flank: ATGAAAATCAAGGAGACGTCAGAGCAGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1520 nhr-130(gk710) V. C. elegans T01G6.8. External left primer: TTCGGATACTTTTCGGTTGC. External right primer: TTCCATTTTTACGGTCCTCG. Internal left primer: GATATGAGGTCCCGATCGAA. Internal right primer: TGAGGCAGATTGGTGTTCTG. Internal WT amplicon: 2444 bp. Deletion size: 1218 bp. Deletion left flank: TTTGAAGCTTCCGCAAAAATTTACATTCCC. Deletion right flank: AAAAAAAATACCGGAAAATAGGCTCCGCCC. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1521 dyf-2(gk678) III. C. elegans ZK520.3. External left primer: GAGGTCGCTCCACTCTCAAC. External right primer: CAGCAGACGCACTCACATTT. Internal left primer: CGGCAATCGCTAGTACATCA. Internal right primer: TCGATGTCGGCTGTGTATTC. Internal WT amplicon: 1671 bp. Deletion size: 202 bp. Deletion left flank: TGCCCATTTGGTCTCCATCGATGAATAATC. Deletion right flank: AAAAAATGAAGTACAAATCATTGAGCTACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1523 dpl-1(gk685)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans T23G7.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk685 homozygotes (sterile, with few eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATTTCCATCAGCAGTGAA. External right primer: ATACCGGCAGCAGCTAGAAA. Internal left primer: TTTGACAACAATCCAATCGC. Internal right primer: AGCTTGTCGGCTCAACGTAT. Internal WT amplicon: 2352 bp. Deletion size: 871 bp. Deletion left flank: ACAAACCAACCGGACTCAGACATTTTTCCA. Deletion right flank: TGGAAACCACAATTTTCAGACCGTAAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1524 nhr-117(gk691) V. C. elegans F16B4.12. Superficially wild type. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 1010 bp. Deletion left flank: TCACAAATCACCTCATCGTAAAACATTTCA. Deletion right flank: CGAGTGCTAAAAGCGGGCTCCGCGCAGACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1525 C34B4(gk702) V. C. elegans C34B4.2. External left primer: TAGGGCGACAGGTTCAAAAC. External right primer: AACTGATGGACCAGGCAGAC. Internal left primer: TGTGAAGTGATGCGGTGTTT. Internal right primer: GTATGGAACGGCATGGAACT. Internal WT amplicon: 2195 bp. Deletion size: 1165 bp. Deletion left flank: TCAACTGATAAGGACACTGTCCTCCGTATT. Deletion right flank: TGATCTTTTCACTCTTTCCCTCTCCACCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1527 nhr-68(gk708) V. C. elegans H12C20.3. External left primer: CGGTTCTAATCCTCCGTCAA. External right primer: AGCGCACCTGTAAATTGCTT. Internal left primer: TGCCTTGTTTGCCAAGATTT. Internal right primer: CTCCAACCCGTCCTTCTGTA. Internal WT amplicon: 1761 bp. Deletion size: 1301 bp. Deletion left flank: TTATATCATGTTTAGCCCACAAATATTCTA. Deletion right flank: TTTCCGGATGGAACATATTATGATAGAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1528 unc-4(gk705) II. C. elegans F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 307 bp. Deletion left flank: TGCAAAGTATTTCACTACAGTTTTACTGTA. Deletion right flank: GCTTAATCCTGCTAGACTTCTACCACAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1530 mei-1(ok2000) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTG GGTTTTTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1531 Y37D8A.2(gk704) III. C. elegans Y37D8A.2. External left primer: TATTGGCCTTGAGAACACCC. External right primer: CTCTTCGTCAGTTTTTCGGC. Internal left primer: TTGAAAGCGCGAAACAATTT. Internal right primer: CTTCAGGCTTCTGGCAAACT. Internal WT amplicon: 1789 bp. Deletion size: 306 bp. Deletion left flank: ATGATTTTTTGAAAATTAAAAAAAAACCAG. Deletion right flank: TTTTGCCTTTTTCTTCAAAATCCAAGCAAA. Insertion Sequence: CC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1532 Y58G8A(gk1022) V. C. elegans Y58G8A. External left primer: GGGCCAGTTGGTCAGAGATA. External right primer: GGGAAGTGATTCGTTCTCCA. Internal left primer: TGCACTCAAGATCAAACGGA. Internal right primer: CTAGACTGGGCGGCATTTAG. Internal WT amplicon: 2306 bp. Deletion size: 210 bp. Deletion left flank: TACATTCAACAAGGGAAATGGGGGCTGGGT. Deletion right flank: TGGGCGACAAACTATTTTTTTCCGGCAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1533 T23D8.3(ok2016) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T23D8.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2016 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGAAGAGCAAGAAGGCGA. External right primer: GGCGCCAATACTTGTTGAAT. Internal left primer: ACACAATTGAGTCGAAGGGG. Internal right primer: CCGGTTCTGTCCAATCAGTT. Internal WT amplicon: 3212 bp. Deletion size: 1434 bp. Deletion left flank: AGGGAATATAAGGAATATTTTGAGACGGGT. Deletion right flank: ATAATTTTCTTGAAGTTTATTTTTCATAAA. Insertion Sequence: ATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1534 elt-6(gk723) IV. C. elegans F52C12.5. External left primer: ACCTCCTCCTCCGACAACTT. External right primer: GGTTCCTGCTGCTTTGACTC. Internal left primer: CCTCCCACCACTTTGTCATT. Internal right primer: GTAGGCATGGCAGCTCTTTC. Internal WT amplicon: 1787 bp. Deletion size: 457 bp. Deletion left flank: ACTTCTACCCAAGTATAACTAAAAAAAAGA. Deletion right flank: TTTCGCAGCATTTTCCCGCCGCCTGACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1535 vha-7(ok2015) IV/nT1 [qIs51] (IV;V). C. elegans C26H9A.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2015 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAACGCCTACAGTGCTCAAA. External right primer: TGAGCAGCATCACCAAACAT. Internal left primer: TGACGACGGTTTCCACAATA. Internal right primer: TCTCCAAAATGCCTACCTGG. Internal WT amplicon: 2817 bp. Deletion size: 1865 bp. Deletion left flank: AATTTCTCGATTTGAACAACAATGATTATG. Deletion right flank: AAGTTCGAATTTTTAGTCAGAATTTGGCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1536 spp-10&hlh-12(ok1923) IV/nT1 [qIs51] (IV;V). C. elegans C28C12.7, C28C12.8. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1923 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCCTTCCATAAATCGCTTG. External right primer: CGGTGTCGAATGAAGGTTTT. Internal left primer: GAGCCGCAATGAAAAACAAC. Internal right primer: GACTGCGGTCAAACTGACAA. Internal WT amplicon: 2109 bp. Deletion size: 939 bp. Deletion left flank: ACTAAAAAAATTCAAGAAAATGTTAATTTT. Deletion right flank: AGTGCCATGGAGAAATTCTTCGAAAACTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1537 isw-1(ok1951) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F37A4.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1951 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCTCGATCACGTCAAAC. External right primer: AGAAATCCGGCAAGCATCTA. Internal left primer: TACAGCTTGCCGGAAAAATC. Internal right primer: TAAACGCCCGAGGTAATTTG. Internal WT amplicon: 2817 bp. Deletion size: 1866 bp. Deletion left flank: TTTCTGGGCTTCCGACATACGACCTTGTTG. Deletion right flank: GCGGCGTCGGACGATTCCGGTTCATCGTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1538 vha-7(ok1952) IV. C. elegans C26H9A.1. Viable, fertile, slow-growing, sometimes sterile. External left primer: CAACGCCTACAGTGCTCAAA. External right primer: TGAGCAGCATCACCAAACAT. Internal left primer: TGACGACGGTTTCCACAATA. Internal right primer: TCTCCAAAATGCCTACCTGG. Internal WT amplicon: 2817 bp. Deletion size: 1749 bp. Deletion left flank: ATTTGAAAACTTTTCTGAAAGTCTCACAAT. Deletion right flank: GTATTTCAAAGTATTGTTGATTCATATGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1539 hpd-1(ok1955) III. C. elegans T21C12.2. Superficially wild type. External left primer: TTGTGGCTGTGCACATTTTT. External right primer: AACATCCCCGTAGCCATTCT. Internal left primer: CGGCAATTTGTCAAAAATCA. Internal right primer: AAAACAGGAAACCGTTGTGG. Internal WT amplicon: 2256 bp. Deletion size: 1363 bp. Deletion left flank: TAATTCAGAACTCGGAAATCACCTTGTTCA. Deletion right flank: GCCCGTGGCTGTGAATTCCTTTCCATTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1542 F58B3.7(ok2027) IV. C. elegans F58B3.7. Superficially wild type. External left primer: TCACTTTCGCTAGCATCCCT. External right primer: GGATCATCATTCGGACAAGG. Internal left primer: TCAATTCACTGTCCGCATGT. Internal right primer: GGAGGACGTTCTGACTTTGG. Internal WT amplicon: 2208 bp. Deletion size: 1136 bp. Deletion left flank: CCGTATTTTTGGGTCTGGGTAACAAAGTCT. Deletion right flank: TTAATTATCAACTTTGTTTAACAGTTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1543 sea-1(gk1023) II. C. elegans F19B10.9. External left primer: ACCGTCACGAATGAGGTTTC. External right primer: CTCTTGCCGACTTCGTTTTC. Internal left primer: TGCCTGAGCAATTTCCTTCT. Internal right primer: TTATATTTGCGGTGCTGTGC. Internal WT amplicon: 2319 bp. Deletion size: 2143 bp. Deletion left flank: GGAATGTTGCCTGAGCAATTTCCTTCTTTT. Deletion right flank: GCTAGAATTGTAGGCAATTGTCGATTTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1544 C12D12.5(gk700) X. C. elegans C12D12.5. External left primer: GCACTGTTGCTGTCCACACT. External right primer: CAGGATTGCAAGTTACGGGT. Internal left primer: AACTTTCTCGTGCTCCTCCA. Internal right primer: AAATGCGCTTTACCACCAAC. Internal WT amplicon: 2128 bp. Deletion size: 1031 bp. Deletion left flank: ATCTGAATCGTTGACTTGCTCAAACGATTT. Deletion right flank: GAATAAAGGTATAATGTGTAAATGAAGCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1545 nhr-142(gk826) V. C. elegans F44E7.8. External left primer: CAACGTCAGTTGCATCGTCT. External right primer: CACCTCTTGTCGTTTCCCAT. Internal left primer: TCGTGAATTCAGGGAGAACA. Internal right primer: TCACTCCAACTCGCACAGAC. Internal WT amplicon: 2183 bp. Deletion size: 1107 bp. Deletion left flank: GAAACATAGTTTTTGTGACTCATAAGACGC. Deletion right flank: AGATTGTGTCTGTGCGAGTTGGAGTGAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1546 nhr-134(gk722) V. C. elegans F44C8.2. External left primer: AAATGCCGAATTACTCGTCG. External right primer: TCAAAAACGCAGCAGACATC. Internal left primer: GCAGATTTGAGATTGCGGAT. Internal right primer: CAGAAGCGATTCTTCTTGCC. Internal WT amplicon: 1783 bp. Deletion size: 915 bp. Deletion left flank: CCAAAAAACTTCGGGACGCCATTTTGGAGT. Deletion right flank: AAAAGAGTTAGTCAAATTTCTTGAAGCTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1547 nhr-285(gk698) V. C. elegans T26E4.16. External left primer: AGAAGCCGACCACAAAACAG. External right primer: ATTTACGCGCATATTTTGGC. Internal left primer: ATATATGACGGCAGCCCAAA. Internal right primer: AGGAGCTCCAACGTGCTCTA. Internal WT amplicon: 2370 bp. Deletion size: 886 bp. Deletion left flank: AAACATGAGCTTTCAAATGAAACATGTTTC. Deletion right flank: TTCTGGATTGCCACCATCATCTATTTTGAT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1548 fbxb-1(ok2052) V. C. elegans T26H2.1. Superficially wild type. External left primer: AACCGGAAGGTTCTCCAAGT. External right primer: TGTACAAGAAGACGACCCCC. Internal left primer: TCTTCCCGATTGATGACTCC. Internal right primer: AAACTTCCGGCAAATTGATG. Internal WT amplicon: 2121 bp. Deletion size: 1037 bp. Deletion left flank: TTTAAACGTTTTTTTTTAACTTCTCTCTTT. Deletion right flank: GGAATGAGGTGGATTTTGAGAACAATCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1549 pfd-5(gk706) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans R151.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk706 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGGAACTGGTGCTTTTTCG. External right primer: ACATTGCAGGGAAACAAAGG. Internal left primer: ATAGCAGCGAGACAAGCACA. Internal right primer: TTGAATTACCGCCAACAGTG. Internal WT amplicon: 1648 bp. Deletion size: 587 bp. Deletion left flank: TCGCAGTTTGTCACCGGTTGAACTCTCATT. Deletion right flank: CCTGCAGTTGCAATTTTCACATCGTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1550 nhr-166(gk688) II. C. elegans C49D10.2. External left primer: CACCATACCGATTTTCGCTT. External right primer: GTGATTATCGCTTTTCCCGA. Internal left primer: TGAAACCAATTGTACCAGCG. Internal right primer: CAGATCACAATGATGCCCAG. Internal WT amplicon: 2288 bp. Deletion size: 762 bp. Deletion left flank: GCAGGTAGATAGGTAGGCAAGTAGGTAGAA. Deletion right flank: CAACTAATCACTCAAGACCATCGAAATGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1551 nhr-117(gk729) V. C. elegans F16B4.12. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 1203 bp. Deletion left flank: AAATATTCCTGCAATCTTATATTTTTCACA. Deletion right flank: GCGTTTTGAATAGACGTTAGACAGCGTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1552 nhr-283(gk724) V. C. elegans F57A10.6. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1027 bp. Deletion left flank: GCCTACCTGCCTACGATGCTCCCACCTACT. Deletion right flank: CATTCAAGAAAAATTTAGGTGCTTAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1553 dnj-19(gk650) V. C. elegans T05C3.5. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 336 bp. Deletion left flank: TGATGTTTTTCCGACGTAAAGCTCTTCGAG. Deletion right flank: AGCAAGTTTGAAGTAAGATTTCTTAATGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1554 nhr-155(ok2026) V. C. elegans C14C6.4. Superficially wild type. External left primer: GGTTCGGTGCAAGGAAATTA. External right primer: TGCGAATTTTGGTGTTTTGA. Internal left primer: AGTACAACGGAGGTGAACGG. Internal right primer: TTTCGAGCACGATTTCACAA. Internal WT amplicon: 2276 bp. Deletion size: 1738 bp. Deletion left flank: AGAAATTAGTCTTGTTTGAATTTTCATATT. Deletion right flank: AATCAGCTCCGCGCTCAGAAAATATTACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1555 F13C5.2(gk716) X. C. elegans F13C5.2. External left primer: GCAAAATCTTTGTTGGGGAA. External right primer: TCGCCGATCAACTTCTTTCT. Internal left primer: CATTCTGCCATTTCCTTCGT. Internal right primer: CGTCAACTGGCTTACGGAAT. Internal WT amplicon: 1651 bp. Deletion size: 385 bp. Deletion left flank: CTCTGTTCTCTCAGCGGTGGCCAGTGTGTA. Deletion right flank: ATTACTCAGAACTATAAAAACAACATTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1557 nhr-86(gk717) V. C. elegans Y40B10A.8. External left primer: AACCCAAAAGTTGCATGAGG. External right primer: AAAATTGGCCAGAAATGACG. Internal left primer: TCTGGCTTGATTTCTCGCTT. Internal right primer: CGCATGAGAACTGCAAGAAG. Internal WT amplicon: 1750 bp. Deletion size: 445 bp. Deletion left flank: AAAATTCAAAAAATTTTCTAAGTTTTATAT. Deletion right flank: AATAATTATTTTAACTCACTCGCAGTAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1558 cyp-13B2(gk726) X. C. elegans K06G5.2. External left primer: TCACCCACGGACATGTAAGA. External right primer: TTTGGGCAGGTACAAACACA. Internal left primer: CTGATTGCGAGGAACAACAA. Internal right primer: GTGAACAGCGGTCTCACAAA. Internal WT amplicon: 1832 bp. Deletion size: 1291 bp. Deletion left flank: TTTGATGCCCTTTCAATGAGAAAACACCTT. Deletion right flank: AGTACAAGTAATTTCAGGTACTATCAGGAA. Insertion Sequence: AGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1560 cnd-1(gk718) III. C. elegans C34E10.7. Unc, sometimes with rounded nose. External left primer: GTTGCGGACAACACACATTC. External right primer: CATGTTAATCGGTGACACGC. Internal left primer: ACGTACTCGATATCTCGCCG. Internal right primer: GTGGAACACCATTCCACACA. Internal WT amplicon: 2138 bp. Deletion size: 1438 bp. Deletion left flank: TACTCGATATCTCGCCGCGATCGTACCGTA. Deletion right flank: TACTCTCTGAGCATATCCAATGCATTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1561 nhr-175(gk720) V. C. elegans F09F3.10. External left primer: CCCGACTCACGGTAGAACAT. External right primer: AACGACCAAAAATGCGAAAC. Internal left primer: ATATTTGTCGCAGCGCTCTT. Internal right primer: AATTGGAATGGGCTGAACTG. Internal WT amplicon: 2080 bp. Deletion size: 778 bp. Deletion left flank: ATGGAGATTGTTTGATCAATTACGGTAAGT. Deletion right flank: ATCTGATGTGAACAAAGTGTTAAAATGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1562 nhr-109(gk712) II. C. elegans T12C9.5. External left primer: TCGAGGCACAATGTCAAAAG. External right primer: AACTGATGGCTCTGCGACTT. Internal left primer: AGAGACATTCTGGAGTGGCG. Internal right primer: ACAAGGCCAGTATCCCAGTG. Internal WT amplicon: 2434 bp. Deletion size: 1587 bp. Deletion left flank: CTGTTTTGGTTTTTAAAATTTTTTTAAATT. Deletion right flank: GGTGTCCTCTTGTTTTGATGAGTTTCGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1563 nhr-229(gk713) IV. C. elegans Y116A8C.18. External left primer: CAAAAATGTTTTGTGCGTGG. External right primer: TCAAATCTGCGTGCTCATTC. Internal left primer: AATTACCCGCATGTTTGAGC. Internal right primer: CCGCTCAGAAATCATTCGTT. Internal WT amplicon: 1761 bp. Deletion size: 593 bp. Deletion left flank: GGCCACTTCCGATTTTAACAATCTTTCTGA. Deletion right flank: GAAACAGTTTTTTAACCAACCTTGTCTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1564 cyl-1(ok1943) V. C. elegans C52E4.6. Superficially wild type. External left primer: GAAGAGGATGGGGAGAGGTC. External right primer: GCAATTTTCGCCTGTCAAAT. Internal left primer: CCCCAAAATGACACAAATCC. Internal right primer: GAAGCGCCTCTTCTGAATTG. Internal WT amplicon: 3228 bp. Deletion size: 1511 bp. Deletion left flank: TTCTTCTTTCGGAGTTGATCATCTGAAAAT. Deletion right flank: ATTTTGTTCTTTTGGCTAAAAATACATAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1565 nhr-116(gk728) V. C. elegans F09C6.9. External left primer: ATTCCTCCTACTCCCTCCGA. External right primer: TAGGGCATTCTTTCATTGGC. Internal left primer: ATCTGTGTCTCTTCGCCCAT. Internal right primer: TCGATCAGCAAACCCTATCC. Internal WT amplicon: 2056 bp. Deletion size: 923 bp. Deletion left flank: TCAGATTTGTTCAATTGTTCTTCTCTCTTA. Deletion right flank: ACGGGTGCAAAACATTTTTCCGGAGGATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1566 F31B9.2(ok2066) X. C. elegans F31B9.2. Superficially wild type. External left primer: CGACAACTCAACCATCGAAC. External right primer: CGAACGGAGCTAGGAACAAG. Internal left primer: CTGCTGATCCAGTCCAACAA. Internal right primer: AACCGATGGGAAATTCACTG. Internal WT amplicon: 2279 bp. Deletion size: 850 bp. Deletion left flank: CAAATAGCATCCCATTTGAACTGTTCTCGC. Deletion right flank: GATGGAAAAAGAAAACGAAATGCTCAGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1569 bbs-2(ok2053) IV. C. elegans F20D12.3. Superficially wild type. External left primer: ATGGTCCGTGAATCCAATGT. External right primer: CTCAACTGAGCAGCTTGTCG. Internal left primer: CCATGGCAACATGTAAGCAC. Internal right primer: CTGCAGCATCGTTAGCTTTG. Internal WT amplicon: 3305 bp. Deletion size: 2306 bp. Deletion left flank: AACGGATGAAATAACATGTTTGGCTCATGT. Deletion right flank: GTGAAAGAGATTATCATTCGTGCTGAAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1571 K11D12.6(ok2024) V. C. elegans K11D12.6. Homozygous viable deletion, detectable by nested PCR. External left primer: CACGTGCAGAAGAGGAATGA. External right primer: GTTGCGACACGAGAATCAGA. Internal left primer: TTCAGGGCAGATTTACGACC. Internal right primer: GGCACAATAAAAGGAAGCCA. Internal WT amplicon: 2290 bp. Deletion size: 1074 bp. Deletion left flank: GGGATGTTCTTTTCTTACTGTTGTGAAAAT. Deletion right flank: GGCTTCCTTTTATTGTGCCAAATTATATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1572 nsy-4(ok2054) IV/nT1 [qIs51] (IV;V). C. elegans Y38F2AL.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2054 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACATGGTGCATCAGTCAAGC. External right primer: AAGCCTAAGCAAGCGCATAA. Internal left primer: GTGGAAGTCATGGTGTGGTG. Internal right primer: ATGCTGAAACCATCCGAGTC. Internal WT amplicon: 2842 bp. Deletion size: 1574 bp. Deletion left flank: AACCTCTCAAGATGTCCAAAATCTAATTTC. Deletion right flank: CAGCTCTCCTCTCCGCGATTGCCGAAGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1575 cgh-1(ok492) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C07H6.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok492 homozygotes (sterile adult, tends to explode at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCAGCTCGAAAATATTGCC. External right primer: GGAAAACCGCAAGGATGGTGG. Internal left primer: TCACGGAGCTAGATGTGACG. Internal right primer: CGTCAAAAAGAACCCGATGT. Internal WT amplicon: 3095 bp. Deletion size: 1043 bp. Deletion left flank: GAGAACATACACAATCTGGACGAGATCACT. Deletion right flank: CCTGGGGTGGCGATGACCAAGTGAACCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1576 F46H5.4(gk701) X. C. elegans F46H5.4. External left primer: GGACGAAGTGAACGAAGAGC. External right primer: AACAAGGTCAATGTTTCGGC. Internal left primer: GTCCGGTGCAAATTCAGATT. Internal right primer: GACAGCCGCACAGCTCTAGT. Internal WT amplicon: 2100 bp. Deletion size: 1294 bp. Deletion left flank: ATTATTATTATTATTATACGTAAACTCGGA. Deletion right flank: GAAGAGAAGGAAGAATAACGCAGCAGGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1578 Y38H8A.4&Y38H8A.3(gk727) IV. C. elegans Y38H8A.4, Y38H8A.3. External left primer: TACGCGAGAAGCCAAAATCT. External right primer: GGAGAGCTTGTTGAGAACGG. Internal left primer: GCCGCTATTTCTGGAGATCA. Internal right primer: TACGATTATTCGCGCATTGA. Internal WT amplicon: 1637 bp. Deletion size: 1192 bp. Deletion left flank: TTGATCACCTTCGCCGCCACTTCAAGCTTC. Deletion right flank: TTGTACAGGCCTATTTCTCAGATTAAGCCT. Insertion Sequence: GAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1579 ebp-2(gk737) II. C. elegans VW02B12L.3. External left primer: AAACCATGTATGGGAACCGA. External right primer: GGAGTCGGCTTGTTTCAGAG. Internal left primer: AAACTTCTGCTCAAGAGGCG. Internal right primer: TAATGTGGAAATCGATGGCA. Internal WT amplicon: 1627 bp. Deletion size: 541 bp. Deletion left flank: TTCGCCCTTCCACCATTGTGGTGAGACTTC. Deletion right flank: CGTCTGGAGCCGCGTACTGTCAGCTCACTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC158 lat-2(ok301) II. C. elegans B0286.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1580 mksr-1(gk738) X. C. elegans K03E6.4. External left primer: GAAGGGCAAATCGATGAAAA. External right primer: GATTCAACGGGTGCTTCTGT. Internal left primer: ATTGGATTCTTCCGGGAACT. Internal right primer: CTAACAGGTTCGAGGCGAAG. Internal WT amplicon: 1986 bp. Deletion size: 921 bp. Deletion left flank: ATTGCTCGGCACATTACAGCGAAAAAAGTT. Deletion right flank: ATTACAATACATTTGTAAAATTGTAAAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1581 mksr-1(gk739) X. C. elegans K03E6.4. External left primer: GAAGGGCAAATCGATGAAAA. External right primer: GATTCAACGGGTGCTTCTGT. Internal left primer: ATTGGATTCTTCCGGGAACT. Internal right primer: CTAACAGGTTCGAGGCGAAG. Internal WT amplicon: 1986 bp. Deletion size: 1241 bp. Deletion left flank: AATCGACTTTTTGGAGTTTTTTGGCAAATA. Deletion right flank: TACATCAAAAAAAATACTGTGATAAAAATT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1582 R10F2.5(gk699) III. C. elegans R10F2.5. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 581 bp. Deletion left flank: CGGGGAGAAGAGTTATCAAAAAGTTGTAAA. Deletion right flank: TGTATTTACGGGAGTCTGTGTGGGCTTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1583 cdh-1(gk747) III. C. elegans R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 1004 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGTAGAAGGGCCCTGATGTGTGTGTGTGTGTG TGTGTGTGTGTGTGTGTGTGTGTGTG. Deletion right flank: AGAGTTTGGGCTTATTTTTTGAAATTTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1584 R10F2.5(gk748) II. C. elegans R10F2.5. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 760 bp. Deletion left flank: CGTTTGAAGTTAGAGGGCGTCAGAGAGTGT. Deletion right flank: TTTGTGTAGATTTACGAGAGTCTGTGTGAA. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1585 nhr-147(gk741) V. C. elegans C03G6.8. External left primer: CGCCCAGATGAACTTTGTTT. External right primer: TGATTTTCCAAAAGCCCAAG. Internal left primer: CCGTACGGATGTATCTGCCT. Internal right primer: CCAAATTGTTGGCGTTCTTT. Internal WT amplicon: 2189 bp. Deletion size: 762 bp. Deletion left flank: AGTGCTAAAGGCTATCATTATGACGTCATT. Deletion right flank: TCTCCAGAAAATTTGATAATTACTTGAACC. Insertion Sequence: CTTGTTTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1586 nhr-225(gk736) V. C. elegans T27B7.2. External left primer: CTTCAAACATTTCCGGGTGT. External right primer: TCAATTATCCGGCAAACTCC. Internal left primer: GGTCGTGTTTCCCAAATTGA. Internal right primer: CCTGCTTGGAAGCCATAGAC. Internal WT amplicon: 2309 bp. Deletion size: 904 bp. Deletion left flank: AGGATAATCACTCATCCAACTAAAATCGAA. Deletion right flank: ACAGAAGCACCTAGAAAAAGGTTTTGTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1587 C16C2.4&ocrl-1(gk752) I. C. elegans C16C2.4, C16C2.3. External left primer: TGTTAGCTGCTGAATCACGG. External right primer: TGCACTTGAATCTGGACAGC. Internal left primer: GAAGTCCTTGCCACGGTAAA. Internal right primer: CCTACAATTCCGAGTGCCAT. Internal WT amplicon: 1898 bp. Deletion size: 1465 bp. Deletion left flank: TCTTTCCAGCGTCCTTCGCATATTCAAAAA. Deletion right flank: AAATAAAGAAAATATTAAACAAAATCGTTG. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1588 nhr-138(gk1018) IV. C. elegans C28D4.9. External left primer: CTATTGTTTCTTGCGTGGCA. External right primer: ACACACAGGACGAATTTCCC. Internal left primer: GAAGCAGGCATGTGTTGGTA. Internal right primer: AGCCCATTTCGATTCAACAA. Internal WT amplicon: 2019 bp. Deletion size: 790 bp. Deletion left flank: AGAGGCATGAGACAACGAAAGCGTATTCTA. Deletion right flank: TTTTTTGAAAGCTTTTCTATTTGCTATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1591 nhr-116(gk746) V. C. elegans F09C6.9. External left primer: ATTCCTCCTACTCCCTCCGA. External right primer: TAGGGCATTCTTTCATTGGC. Internal left primer: ATCTGTGTCTCTTCGCCCAT. Internal right primer: TCGATCAGCAAACCCTATCC. Internal WT amplicon: 2056 bp. Deletion size: 810 bp. Deletion left flank: TTTGAATACATTCTCGAAACTCTCTACCGC. Deletion right flank: ATAATCCGGACTGGAACGAAATGGACGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1592 nhr-15(gk744) V. C. elegans F33E11.1. External left primer: GGACACACGTTCATAATGCG. External right primer: ACTTGACGGGAATGTTTTCG. Internal left primer: GGGCTCCACATCTTTGCTTA. Internal right primer: ATGTTATGAAGGTGGCCGAG. Internal WT amplicon: 2369 bp. Deletion size: 2143 bp. Deletion left flank: CGTTTGTCCCGTTGTCCCGTTTTTTGAGTG. Deletion right flank: GTGAAATTTGATGCAGATAAAATTTTGTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1593 nhr-229(gk743) IV. C. elegans Y116A8C.18. External left primer: CAAAAATGTTTTGTGCGTGG. External right primer: TCAAATCTGCGTGCTCATTC. Internal left primer: AATTACCCGCATGTTTGAGC. Internal right primer: CCGCTCAGAAATCATTCGTT. Internal WT amplicon: 1761 bp. Deletion size: 722 bp. Deletion left flank: TTTTCTCTGCTTCCCTGCGCGTCCTCAAAC. Deletion right flank: CATTCTCAAATAGAAACAGTTTTTTAACCA. Insertion Sequence: CATTTTCGTAGCGTTTTTCTCTTGCTTTACATCCTTTTCCAAACTTGCGATTCTATAAA TAAAAAATTTGAATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1594 mec-8(ok2043) I. C. elegans F46A9.6. Superficially wild type. External left primer: ATAGCAAGTGTGTGAGGGGG. External right primer: CCGACACAACATTCGACATC. Internal left primer: CCTCGATCGTTGGCTGTTAT. Internal right primer: ATTTCTTTGTCGCCCCTTTT. Internal WT amplicon: 2265 bp. Deletion size: 1117 bp. Deletion left flank: TCGTTGGCTGTTATCTGGAATCCTTGTAGT. Deletion right flank: TGTTGCTCATTGAAAAGAGCTGCTGATTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1595 +/szT1 [lon-2(e678)] I; sup-12(ok1843)/szT1 X. C. elegans T22B2.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1843 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGCAGGTCAATTTCACGGTA. External right primer: CAATGAGGATGTGCAAATGG. Internal left primer: AATGTACGGCCAAGTCCAAG. Internal right primer: TATTGCTGGGACGACAATGA. Internal WT amplicon: 2626 bp. Deletion size: 1803 bp. Deletion left flank: CGCCGAACCAGTAGTTGGTGAGTTTCCTGT. Deletion right flank: CAATGATTTTACTTTTCATTCTATCCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1597 nhr-191(gk742) I. C. elegans F55D12.3. External left primer: AAAGGGGGAGAGAGAAACGA. External right primer: TTTGGTGCTGCTGAAAATTG. Internal left primer: AGAGACGCAGAGAAACGAGG. Internal right primer: TGACGATGGCAAATATGGAA. Internal WT amplicon: 1972 bp. Deletion size: 509 bp. Deletion left flank: TACGATAAGGTTCAGCTATGTATATCATTT. Deletion right flank: GTTTTCACAAATGCATTCTCGCTGGAATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1598 acr-20(ok1849)/mT1 II; +/mT1 [dpy-10(e128)] III. C. elegans R06A4.10. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1849 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGTCTTTTGGATGACACCG. External right primer: CCGCCAAATTACCTACCAAA. Internal left primer: TACTGTATCCGGAGCCATCC. Internal right primer: TGGGTGGTTGACCAATTTCT. Internal WT amplicon: 3238 bp. Deletion size: 1398 bp. Deletion left flank: CCATCCACCAGTAGAAAAAACCAATCAGAT. Deletion right flank: GATCAGAATAATACAATCCTAACTGTTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1599 +/szT1 [lon-2(e678)] I; mrp-5(ok2067)/szT1 X. C. elegans F14F4.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2067 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGGCAGGTGAAACAGTTC. External right primer: GATGGGAGCAGATTTTCAGC. Internal left primer: ATCTCATTGCCGATTGGAAC. Internal right primer: GTCCAGTCGTCCCAGTTGTT. Internal WT amplicon: 3301 bp. Deletion size: 1167 bp. Deletion left flank: CATAAAAATAGCACCACTGTTGCAGTCCAA. Deletion right flank: ACTCGTCTTCATTTCCAAAAATTCAGTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC16 haf-2(gk13) II. C. elegans F43E2.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC160 trp-1(ok323) III. C. elegans ZC21.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1600 ZK39.7(ok2085) I. C. elegans ZK39.7. Superficially wild type. External left primer: GATCGGAGCCCATAGAATCA. External right primer: AACATTAAGGGGTCGCACTG. Internal left primer: CAATGCACACCAACCAACTC. Internal right primer: ATGACCAACTTGCAACCCTC. Internal WT amplicon: 2440 bp. Deletion size: 1257 bp. Deletion left flank: AATTATGGTATAGCTCTGAATATTAAACCT. Deletion right flank: CAAGCCGAAATGAGACATTCTGGCACCACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1601 Y38H8A.4&Y38H8A.3(gk749) IV. C. elegans Y38H8A.4, Y38H8A.3. External left primer: TACGCGAGAAGCCAAAATCT. External right primer: GGAGAGCTTGTTGAGAACGG. Internal left primer: GCCGCTATTTCTGGAGATCA. Internal right primer: TACGATTATTCGCGCATTGA. Internal WT amplicon: 1637 bp. Deletion size: 1372 bp. Deletion left flank: CGTGGTATACCGTATACGTATACGGTAGAT. Deletion right flank: TTAATTTGAATTTTGTCAGCATTTTTGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1602 K06A1(gk750) II. C. elegans K06A1. External left primer: CTGTGGGATTTGCAGGACTT. External right primer: CCGGATCGATTGCTAGAGAG. Internal left primer: ACAAACATTGACAGGAGCCC. Internal right primer: CCAATTTCTCGGGAATGAAA. Internal WT amplicon: 2095 bp. Deletion size: 552 bp. Deletion left flank: TTCTCCAATTTCCTGCCTATTTTGGCATAT. Deletion right flank: ATCAGAAATTTTACAATTTTCTTAATTTTT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1603 nhr-68(gk755) V. C. elegans H12C20.3. External left primer: CGGTTCTAATCCTCCGTCAA. External right primer: AGCGCACCTGTAAATTGCTT. Internal left primer: TGCCTTGTTTGCCAAGATTT. Internal right primer: CTCCAACCCGTCCTTCTGTA. Internal WT amplicon: 1761 bp. Deletion size: 726 bp. Deletion left flank: ACAAAATTTAACCGATTTCAAAAATTATAA. Deletion right flank: TTGAACTCTATCGTATTCTGGGCGGTACTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1604 F34D6.2(gk1024) II. C. elegans F34D6.2. External left primer: TCCTGTCAACCCTCAGCTCT. External right primer: ATAATGCATTGCAGAGCACG. Internal left primer: ATGGTTCACACGGTTTCTGG. Internal right primer: ACACAACGAGAGCCCATTTC. Internal WT amplicon: 2355 bp. Deletion size: 1207 bp. Deletion left flank: TGTTTTTCACAACTCTACAAACTATGCCTA. Deletion right flank: ATTGTCTTGTTTTCTCTCCGGCCTGCTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1605 tab-1(gk753) II. C. elegans F31E8.3. External left primer: GCACAAGTTGTTGGGGAAGT. External right primer: TTCTTGTGCTTCATTCGTCG. Internal left primer: ATGAGAGGTCGAATTGTGCC. Internal right primer: CAAATTGAGAGCATTTGCCA. Internal WT amplicon: 1727 bp. Deletion size: 820 bp. Deletion left flank: ACTGAACATTACGAGACAATCAATTTCCAT. Deletion right flank: TGCAGCAGCAGCGTTTCCAATAGAACATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1606 elt-6(gk754) IV. C. elegans F52C12.5. External left primer: ACCTCCTCCTCCGACAACTT. External right primer: GGTTCCTGCTGCTTTGACTC. Internal left primer: CCTCCCACCACTTTGTCATT. Internal right primer: GTAGGCATGGCAGCTCTTTC. Internal WT amplicon: 1787 bp. Deletion size: 965 bp. Deletion left flank: TTTCACTTGAATCATCATTTTTGCATTTTC. Deletion right flank: AGGAGCTGGTGGAACTTTAGAAATAAGCCA. Insertion Sequence: GAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1607 nlr-1(tm2050) IV/nT1 [qIs51] (IV;V). C. elegans F20B10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2050 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGTTCTGTGACGTCCCAGT. External right primer: GTCGGCGTTAGATGACTATG. Internal left primer: TACGGCAAAGTGAATGGCTT. Internal right primer: ACAGCTGATCTACCACACTC. Internal WT amplicon: 1775 bp. Deletion size: 1078 bp. Deletion left flank: CAATGAGTTAATTTCCAACAAAATTATTTT. Deletion right flank: GTAAGTGAGTACCGAACTGCTCCGGGCTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1608 spr-1(gk734) V. C. elegans D1014.8. External left primer: TTGTTGGACGAGGTACTCCC. External right primer: AGGCTTCATGCAGCTTGTTT. Internal left primer: GGACGATTCATCGCGTTATT. Internal right primer: TTCAGAACAGCATTTCCGGT. Internal WT amplicon: 1855 bp. Deletion size: 1317 bp. Deletion left flank: ATACTAAAAACATAAATTTGATTATTAAAA. Deletion right flank: AGGAAACATGTTTTTATTTTATTTTTAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1609 kin-10(ok2031) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01G9.6. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2031 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCGCAAAATTTCACGTTT. External right primer: TTCGACAGAAAACTGCTGGA. Internal left primer: GTGACGAAGACAGGCACAAA. Internal right primer: TTCACCCAACCTGTACCCAT. Internal WT amplicon: 2149 bp. Deletion size: 966 bp. Deletion left flank: AGTCGTGTTGTTTTGTGCTGCGGCAACGTT. Deletion right flank: TGGAAGCATTGGCTGATTTTCACAGTAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC161 mtm-6(ok330) III. C. elegans F53A2.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1610 T08B2.5(gk721) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T08B2.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk721 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATTTGGTTGAGACGATCCG. External right primer: AAGGTAACATCGCCATCGAC. Internal left primer: CGTGACATGAGATCAGGCAT. Internal right primer: GCTTGTCAAACCTCACGGAT. Internal WT amplicon: 2344 bp. Deletion size: 914 bp. Deletion left flank: GGAATTGTCTACAGTGGATGTATGAACACT. Deletion right flank: GGTTGCCATCAAATTCAAATTTCCAGGGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1611 +/mT1 II; vab-7(gk709)/mT1 [dpy-10(e128)] III. C. elegans M142.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk709 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTTCCCCTCTTCTATTGGC. External right primer: CGACACGCAACACCAATTAC. Internal left primer: AATCCACCGTAGTCACCGAG. Internal right primer: TCAGAGCATGTTTCCCAGTG. Internal WT amplicon: 2427 bp. Deletion size: 1019 bp. Deletion left flank: TAAATTTTTGTAGTTTTTTAGGGATTTTTT. Deletion right flank: TCACTTGTGGAGATGGTCGCCGCATCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1612 nhr-283(gk735) V/nT1 [qIs51] (IV;V). C. elegans F57A10.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk735 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1634 bp. Deletion left flank: TGAGGTGTAGATCTTCTGATACGTGGACAG. Deletion right flank: AATTTGAGGGTGCTTATGATTTTTGGTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1613 T15B12.1(gk751) III. C. elegans T15B12.1. External left primer: AAAAATTGCCAGAATCGTCG. External right primer: CAAAGGCGGTTTGTGAAAAT. Internal left primer: ATTGGCAATCTCCGTTCATC. Internal right primer: GTTAACAGCCAGATGCTCCC. Internal WT amplicon: 1544 bp. Deletion size: 622 bp. Deletion left flank: TGTGTTCTTTTGATTAATTGATATGCATTC. Deletion right flank: ACACTTCCAAATCGTCCAAATATCGGAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1614 ebp-2(gk756) II. C. elegans VW02B12L.3. External left primer: AAACCATGTATGGGAACCGA. External right primer: GGAGTCGGCTTGTTTCAGAG. Internal left primer: AAACTTCTGCTCAAGAGGCG. Internal right primer: TAATGTGGAAATCGATGGCA. Internal WT amplicon: 1627 bp. Deletion size: 885 bp. Deletion left flank: CCACTGTTAACCATAGGAAATGCACTGATT. Deletion right flank: GACCGGTGGCTGCCGCTCCGCCAAAGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1617 nhr-7(gk763) IV. C. elegans F54D1.4. External left primer: CAGATGGTGGAGGAACTGGT. External right primer: GGTTTTGACACCTCTCCGAA. Internal left primer: CGAATTCGAGATGCCAGATT. Internal right primer: TCACGCATTGTTCGAAAGTT. Internal WT amplicon: 1953 bp. Deletion size: 1329 bp. Deletion left flank: ATATTGAAGTCTTGTTTCTACTGTGTTTGA. Deletion right flank: ACAAAAGCAAAAATTACCCTTGAAGAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1618 Y71H2AM.3(ok2025)/sC1 III. C. elegans Y71H2AM.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2025 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGTCATGTTTTTCCGGTGA. External right primer: TCTCGCTTCACGTTTTTGTG. Internal left primer: TTTTATTCGCATTTCCTCCG. Internal right primer: TCGGCTTTCTCCTCATGTTT. Internal WT amplicon: 2726 bp. Deletion size: 1372 bp. Deletion left flank: CACAAGTGGCTCACCGACTAAAAAATCGAG. Deletion right flank: ACTATTCAATGTCTTCCAGATGATGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1619 +/szT1 [lon-2(e678)] I; sex-1(ok2071)/szT1 X. C. elegans F44A6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2071 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGGACTGGACCTACAGAGGG. External right primer: GGCAGCAACATCTACAGCAA. Internal left primer: TGTGTTGGAATGAAAACGGA. Internal right primer: AGGGACCAGATCAGTTGTGC. Internal WT amplicon: 3077 bp. Deletion size: 2408 bp. Deletion left flank: TACTAAGTCGATTCAATTCATGAATACATT. Deletion right flank: CACAGTCTTTTTACCACGCCTACATCGCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1620 F52B5.2(ok2069) I. C. elegans F52B5.2. External left primer: TTCAAAAATCCCAAAAACGG. External right primer: GTATGAGCACAATCCTCGCA. Internal left primer: CCAAAGAAGTGAATGGGTCC. Internal right primer: AGCGATGGTATTTTTGGCAG. Internal WT amplicon: 2275 bp. Deletion size: 851 bp. Deletion left flank: CTTCTTTTGTAATATTCTCGATTTTCGAAA. Deletion right flank: GCAACGGTTTCCCCGTTTTTTTTTAAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1621 T26G10.1(ok2057) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T26G10.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2057 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCACCATCAGCAATATCCA. External right primer: TCCGTTGGACTTTCCAATTC. Internal left primer: TTTTGTCGTCGCTTCTTTCC. Internal right primer: AAGTGTCGTCAGATTGCGTG. Internal WT amplicon: 2101 bp. Deletion size: 1183 bp. Deletion left flank: AGTCGGAAAATTCAAAATCTAACCTAAATT. Deletion right flank: CTCTGAAGACAATTAACCAGTTATTTCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1622 let-765(ok2058) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F20H11.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2058 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAATCGTATTGCTGCTTCCA. External right primer: CGGAGCTGGTGTAGGAAAAG. Internal left primer: GTCCATTCGAATCTTTCCGA. Internal right primer: TGCTGAACGTGATCTTCGAG. Internal WT amplicon: 3229 bp. Deletion size: 1540 bp. Deletion left flank: CACAGATTCTAGATGAAGTGATAAAATCCG. Deletion right flank: TTTTGAAGTTCTAAGACCATTCGTCCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1623 set-3(ok2114) III. C. elegans C07A9.7. Superficially wild type. External left primer: TTGACGAGTTTGACGACGAG. External right primer: TTGTGGATGTCATGGTTGCT. Internal left primer: TTAATTTCGCTGATTTCGCC. Internal right primer: CAGAATGGTGGAAGTTCCGT. Internal WT amplicon: 3109 bp. Deletion size: 2295 bp. Deletion left flank: AAATTTTCAATTAATTTCGCTGATTTCGCC. Deletion right flank: TTTTTTGTGAACGCGAAAAGGTGTGCGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1624 F54H12.5&F54H12.6(ok2133) III. C. elegans F54H12.6, F54H12.5. Superficially wild type. External left primer: TTGGATGGTCTTCTTCTGGG. External right primer: CGAAAATGAATGGGAGGAGA. Internal left primer: TGGAGTGGAAATTTCTTCCG. Internal right primer: CATGGGGTTTCGACAGACTT. Internal WT amplicon: 2179 bp. Deletion size: 1993 bp. Deletion left flank: AACCACGGTAACGGTCTCGACACGACAAGT. Deletion right flank: CTTTTCAGGAGTGAAACACGAAGGAATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1625 dylt-2(gk762) X. C. elegans D1009.5. External left primer: TGAAAAATTGCGAACACCAA. External right primer: AGTCTGATTCTGGCGCTGTT. Internal left primer: TTTATGGAGAGATGGCCGAG. Internal right primer: GTCATTTCCATTGCTCCGAT. Internal WT amplicon: 1735 bp. Deletion size: 1182 bp. Deletion left flank: GAATCCCACTCTCTTCAGTTCTTTTTAATT. Deletion right flank: TTTCAAGAAATAGAGGAATCACAATAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1626 nhr-7(gk757) IV. C. elegans F54D1.4. External left primer: CAGATGGTGGAGGAACTGGT. External right primer: GGTTTTGACACCTCTCCGAA. Internal left primer: CGAATTCGAGATGCCAGATT. Internal right primer: TCACGCATTGTTCGAAAGTT. Internal WT amplicon: 1953 bp. Deletion size: 1031 bp. Deletion left flank: TTCAAATAATAGCTTTATGAACTCTCTAAT. Deletion right flank: TTCAGAAAGTTGTTTTCGTGATGATGGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1628 nhr-283(gk764) V. C. elegans F57A10.6. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1323 bp. Deletion left flank: TTCTGATATCCCAGGAAGGCCTGAAAAATT. Deletion right flank: GTTAATTTTTTTAAAATCCCAGCTCAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1629 nhr-99(gk758) V. C. elegans M02H5.1. External left primer: CTCTCAACTCCCCGTCCTTA. External right primer: TATCTCGACTGCCACGACAC. Internal left primer: GAACTATTCAAGCCCGGACA. Internal right primer: TGCGCTATTTCTCCTCCCTA. Internal WT amplicon: 1709 bp. Deletion size: 865 bp. Deletion left flank: AATTTTGCGGACGGTAAAAGTTCAAATTTT. Deletion right flank: ATTTGCCGGAAATTTTCAATTTCGGCAATT. Insertion Sequence: TTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1630 Y54E5A.2(ok2070)/hIn1 [unc-101(sy241)] I. C. elegans Y54E5A.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTTTCGGTGTTGAGAGCGT. External right primer: TGGTGCATGATTTGTGGATT. Internal left primer: GCTCACAACTTCACGCAGAG. Internal right primer: TAAACACCAAGTGGCACCAA. Internal WT amplicon: 2168 bp. Deletion size: 1739 bp. Deletion left flank: AATTTCACGGGGTATATTTAATTTTTAATT. Deletion right flank: TTTTATCATGATATCTCAAAAGTTGAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1631 dyf-3(gk760) IV/nT1 [qIs51] (IV;V). C. elegans C04C3.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk760 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACCCATCATGTTACCGT. External right primer: GAAGCTCGTCGACCGTAGTC. Internal left primer: TCACGCATCCTTCTTCTCCT. Internal right primer: TTGCAGGGAGTTTCTATGGG. Internal WT amplicon: 1853 bp. Deletion size: 736 bp. Deletion left flank: TACTCGTCCATATACTGAGGTCGGAAGGAC. Deletion right flank: CGGACCTCCTGCATCTGAACTTTCGACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1632 C17E4.6(gk787) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C17E4.6. Maternal effect lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk787 homozygotes (fertile WT whose progeny arrest before reproducing). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTGTGTGAAGAGACGCAGA. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGAGCGCGTTTGCACTAATC. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2178 bp. Deletion size: 796 bp. Deletion left flank: AGAAGGAAGCTCCAATGACGAACATTCAAA. Deletion right flank: ACTGTTTTTGAAGAAACGTTTAAAAAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1633 unc-120(gk719) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans D1081.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk719 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTACCTTCACCCCTCCAA. External right primer: CTATAACACGGGACCCCCTT. Internal left primer: GGTCCTTCCATTCCCATCTT. Internal right primer: GGCTGACATAACATCGCTCA. Internal WT amplicon: 2150 bp. Deletion size: 972 bp. Deletion left flank: ATGTTTCTAAAATTTATCTGCATTTTCATA. Deletion right flank: AAATATCCTGACTCACCTATTTAGTTGCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1634 Y37E11AL.6(ok2115) IV. C. elegans Y37E11AL.6. External left primer: AGAAGGGCGGCAATTATTTT. External right primer: TGGTGGGGAAGTGCATTATT. Internal left primer: TTGCACCATGTTGTTCCAGT. Internal right primer: GGCAGAAAAAGTGTCTGGGA. Internal WT amplicon: 3288 bp. Deletion size: 1035 bp. Deletion left flank: CGCCCGGAAGCACAGATGAACACGAAATGT. Deletion right flank: CGAATCCCGAGCCGATATTTATCTACAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1635 nono-1(gk1206) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F25B5.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1206 homozygotes (Unc, nearly Ste, has a few progeny but can't maintain population). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCCCGTGACGAGATATCAG. External right primer: TCAAATTGCAACTCAACCCA. Internal left primer: AATCGGGAATTGGACACAAC. Internal right primer: TCGCATTATATCGCAGCTTG. Internal WT amplicon: 2308 bp. Deletion size: 1026 bp. Deletion left flank: ACTTCACAAATCAGTGGTTTCGGACTCCTA. Deletion right flank: AAAAGAAAACTCTAGAAGCTTCATAAATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1636 rsp-7&D2089.2(ok2079)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans D2089.1, D2089.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2079 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAATTACGTCGCCGGTTTA. External right primer: CACTGTTTTTCGGAGCCAAT. Internal left primer: ACATTTCGACATCGGCTACC. Internal right primer: CACCTCAACTTATTCGGGGA. Internal WT amplicon: 3201 bp. Deletion size: 1429 bp. Deletion left flank: TAAGCCATTTCTCGAAGAAAACAAAGCACA. Deletion right flank: AGATCCAAAGATCGAAAGCGTGACAAGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1637 mksr-1(gk789) X. C. elegans K03E6.4. External left primer: GAAGGGCAAATCGATGAAAA. External right primer: GATTCAACGGGTGCTTCTGT. Internal left primer: ATTGGATTCTTCCGGGAACT. Internal right primer: CTAACAGGTTCGAGGCGAAG. Internal WT amplicon: 1986 bp. Deletion size: 620 bp. Deletion left flank: TGTGCAAATAATCGTATTTTTCAAAAAAAG. Deletion right flank: TTCACATATTACAGAAATGTGCATCAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1638 ZK1025.4(ok2101) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ZK1025.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2101 homozygotes (sterile, lays unfertilized eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTGCTGTTCGGGAAAAAT. External right primer: CAACTTTCCGGCTTGTAGGA. Internal left primer: TTTCCGGGTGAGTGAGTTTC. Internal right primer: GCGTCCGTGAAATTTGAGAT. Internal WT amplicon: 3284 bp. Deletion size: 1617 bp. Deletion left flank: TAAGCTTGGCGTCAGAGGCGAGCGTTAGCT. Deletion right flank: TTTCCGCCAGATCGGCAAATTTGCCGGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC164 swd-3.1 dph-1(ok329) III. C. elegans C14B1.4, C14B1.5. Slow-growing, small broods. Deletion removes 3' end of C14B1.4, 5' end of C14B1.5. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1640 dcap-1&Y55F3AM.13(ok2139) IV. C. elegans Y55F3AM.13, Y55F3AM.12. External left primer: AAATCAGGGAAATATCGGGG. External right primer: TTTTCCAGGGTAAATCACGC. Internal left primer: GTCGTCGGTTTGCATTAGGT. Internal right primer: ACGTGGGAGACCAATCTGAC. Internal WT amplicon: 2730 bp. Deletion size: 1252 bp. Deletion left flank: AGCTTCTGGAGCATTGGCGGCATTTGTTCG. Deletion right flank: TTCCTACTTTTCCCAGCCAAATCGCTTGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1641 daf-10(gk795) IV. C. elegans F23B2.4. External left primer: TGCAATACCCCAAATTGGTT. External right primer: AGTTTGGTTGAGATCGTCCG. Internal left primer: TTATTGACGGTTCCTCGGTC. Internal right primer: GCTGATCGCCCATATCTCAT. Internal WT amplicon: 1963 bp. Deletion size: 834 bp. Deletion left flank: TTAAACTAATATTTGCGGTAAAATATGTAC. Deletion right flank: CCAAAAAAAAAAACTGTTCCCCATGGAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1642 dnj-11(gk1025) IV. C. elegans F38A5.13. External left primer: ATCCAACTCGGCATCATCTC. External right primer: AATGCAAATCCGCTCAATTC. Internal left primer: TGAAGTCGAATCTGCGAGTG. Internal right primer: GCGAGTTTCTTCAGACGCTT. Internal WT amplicon: 2118 bp. Deletion size: 563 bp. Deletion left flank: ATGGTCCAATATCAAGCCAGTGCCAGAACT. Deletion right flank: GCGTAAGCGTCTGAAGAAACTCGCTGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1643 C12D12(gk797) X. C. elegans C12D12. External left primer: GCACTGTTGCTGTCCACACT. External right primer: CAGGATTGCAAGTTACGGGT. Internal left primer: AACTTTCTCGTGCTCCTCCA. Internal right primer: AAATGCGCTTTACCACCAAC. Internal WT amplicon: 2128 bp. Deletion size: 1665 bp. Deletion left flank: CTGACGAGGCGGCAGCAATTGGCGTTGTCT. Deletion right flank: ATCATTAGAATAATTTGTGCAAAATCTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1644 cnd-1(gk781) III. C. elegans C34E10.7. External left primer: GTTGCGGACAACACACATTC. External right primer: CATGTTAATCGGTGACACGC. Internal left primer: ACGTACTCGATATCTCGCCG. Internal right primer: GTGGAACACCATTCCACACA. Internal WT amplicon: 2138 bp. Deletion size: 1176 bp. Deletion left flank: ACGAGGTTGGACCTGGAAAAGAGAGGGGAT. Deletion right flank: GTTCGTTGGGAAGGATGGAATGGTTTCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1645 mltn-13(gk766) X. C. elegans F15A8.7. External left primer: TTGGGCCTGAGACCTTATTG. External right primer: CCCCCTCAAACTCAAGCATA. Internal left primer: AGCCTGATCCGATTTCAATG. Internal right primer: TCAACTGTGGTCATTTCGGA. Internal WT amplicon: 2295 bp. Deletion size: 1704 bp. Deletion left flank: AATACCTCTACTAAAAATTTTTCATCACTG. Deletion right flank: AAAAATACATTTACTTAACATTCAGTTGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1646 fkh-7(gk793) IV. C. elegans F26D12.1. External left primer: CGGAGGAGGGAGTAAAGGAC. External right primer: CTTGAAGCCTACTCCGTTCG. Internal left primer: AAACAACCAACCAGCCAAAC. Internal right primer: TTAGAAACAGCAGCCGTCAA. Internal WT amplicon: 2256 bp. Deletion size: 952 bp. Deletion left flank: AGGTCCTTTCGAAGGACTACCTTTATATTC. Deletion right flank: TTCTTCCGGAAACTCCGCCCATAAATGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1647 unc-39(gk765) V. C. elegans F56A12.1. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAGACAAGGATAGCACGCAA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: TTTACGACTTGGCAGCTGGT. Internal WT amplicon: 2117 bp. Deletion size: 1130 bp. Deletion left flank: AGGTGCCTCCCCCTCTTGGACTGTTGTACC. Deletion right flank: TTCCGCAAGTATCTGATATAGAACTTTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1649 C01G12.8(ok2056) II. C. elegans C01G12.8. External left primer: ACGAGGAGGTTCCAAAGGAT. External right primer: AGCCAATGAAGAATGCGAAC. Internal left primer: ACGTAAGGGAGACAGCAGGA. Internal right primer: GCGAGAAATCCAATTTCCAA. Internal WT amplicon: 3309 bp. Deletion size: 1615 bp. Deletion left flank: CACCTCTCAAAGCTATTGTCTTCTTCATGG. Deletion right flank: GCGTCAATTGTGACTGGTGTTGAGGAGGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC165 ttn-1(gk135) V. C. elegans H05O09.1 W06H8.8 Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1651 C48A7.2(ok2116) IV/nT1 [qIs51] (IV;V). C. elegans C48A7.2. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2116 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTACGCCGGAAAGACAAAAA. External right primer: AAATCAATGAATGTGGGGGA. Internal left primer: TAAATGACGCCGAATTGTCA. Internal right primer: ATCGAAACTGCGCTGATCTT. Internal WT amplicon: 3253 bp. Deletion size: 1307 bp. Deletion left flank: TTGTTACAATAACTATGCAAATGTAAATAT. Deletion right flank: CCCCAAGATATAGTTTCGATAAGTAAATAC. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1654 nhr-259(gk792) I. C. elegans C27C7.8. External left primer: TCCAAAATTCTCGTTCGGAG. External right primer: TCGACTTACCTCTGACCGCT. Internal left primer: TTCGGAATTTCTGTCCGAAG. Internal right primer: GTCGATGCACCAATGTTGAC. Internal WT amplicon: 2373 bp. Deletion size: 1439 bp. Deletion left flank: AAAAGGTTGGTAGTCGTCGGGAAATATATA. Deletion right flank: CCCACGAACCCACAATCACCATCCGCATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1655 nhr-99(gk791) V. C. elegans M02H5.1. External left primer: CTCTCAACTCCCCGTCCTTA. External right primer: TATCTCGACTGCCACGACAC. Internal left primer: GAACTATTCAAGCCCGGACA. Internal right primer: TGCGCTATTTCTCCTCCCTA. Internal WT amplicon: 1709 bp. Deletion size: 638 bp. Deletion left flank: CAGGGCGTGTGCCATGTTTTTCAGGTGGGT. Deletion right flank: TTTCACGCTGTGGCAAGATGATTTCCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1656 nhr-13(gk796) V. C. elegans Y5H2B.2. External left primer: CCCAGTGGAATGCAACTTTT. External right primer: TTGCATTCTCCTCGTAGCCT. Internal left primer: CGAGTGGAATTCTGAGAGCA. Internal right primer: CGAGACGGTAGCAGAAGACC. Internal WT amplicon: 2106 bp. Deletion size: 320 bp. Deletion left flank: TTTGCATTTATTTGCGTTTTTTTGGCTATA. Deletion right flank: TCAGTGTATTGACCAACCGGATGCCTGTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1657 uaf-1(gk800) III. C. elegans Y92C3B.2. External left primer: ACCGGTTACTGTAGGCATCG. External right primer: TCGGTGATTTTGGTGTGAAA. Internal left primer: AGCGTTATTTGCTGCGATTT. Internal right primer: TCACAGGAGCACATTTGACC. Internal WT amplicon: 1809 bp. Deletion size: 737 bp. Deletion left flank: GTTTTGCCATGAAAAAGTGCAAATTTAGGT. Deletion right flank: TCAATTTTTCGCTCTAAAATCGAATTTCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1658 cdh-1(gk784) III. C. elegans R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 579 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGT. Deletion right flank: TTGGGGGTAGATTTACTGAGGATATTGTAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC166 ppt-1(gk131) V. C. elegans F44C4.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1661 nhr-230(gk814) V. C. elegans Y17D7A.1. External left primer: GCCCGCACTGTGTAATTTTT. External right primer: ATTTTGCGTGTTGTCGATGA. Internal left primer: GGTCGAACCTGCGACATACT. Internal right primer: TGGGACAATTTGGGACATTT. Internal WT amplicon: 2267 bp. Deletion size: 1916 bp. Deletion left flank: TTTGTTTTGAACTAGAATTTGCAAATTCTG. Deletion right flank: AAAACTCAAACTTCGAAAACCTGGACAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1662 lys-6(ok2075) IV. C. elegans F58B3.3. External left primer: TTGTTTGATTGCACGTGGTT. External right primer: GATCGTGGTGTGGTTCACAG. Internal left primer: TTGGCTTCCAAACCATTTTC. Internal right primer: ATCAATGCCTCTGGATCGAC. Internal WT amplicon: 2135 bp. Deletion size: 1265 bp. Deletion left flank: GAGAACGCTTTCGTGAATCGGGATTTAAAA. Deletion right flank: TTTAGGCAAGGGAAGATGTATCCATCGACA. Insertion Sequence: GGCAAGGGAAGAAGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1663 F47C12.1(ok2088) IV. C. elegans F47C12.1. External left primer: ATGTTCGCAACGGAAAAATC. External right primer: GCAGAGCATGCAAGTGTTGT. Internal left primer: ATGAGGACAACATCGCAACA. Internal right primer: CTCTGGAAGTCGATCCTTCG. Internal WT amplicon: 3320 bp. Deletion size: 2317 bp. Deletion left flank: CTTCTAAATCCGATGGGCTCACCGTAACTC. Deletion right flank: GACTGCTGGATGTCCTAGCATAACCGCCAA. Insertion Sequence: GATGTGGGTGTGGGTATTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1664 F25F8.1(ok2170) I. C. elegans F25F8.1. External left primer: GCGACTAATTGGCCATCTTT. External right primer: AAAAACGCAGAAGGTAGCGA. Internal left primer: AGAATCAAAGCATGCCGAGT. Internal right primer: GTGCTCAACGCCTTCTTCTC. Internal WT amplicon: 3183 bp. Deletion size: 1851 bp. Deletion left flank: ATGCACTTTTTGCAACTTTGTGCAATTAGG. Deletion right flank: TTTTTAATGTTTCAAAAGTGTAGATTATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1666 met-1(ok2172) I. C. elegans C43E11.3. External left primer: TGGTGAGCCAGATCACACAT. External right primer: CGGAAAACGAAAAATCGAAA. Internal left primer: CACTGCATGCTTTTGCACTT. Internal right primer: TTCATCCATTTTCGCATTGA. Internal WT amplicon: 3224 bp. Deletion size: 1271 bp. Deletion left flank: TGCTGCTCATTTTTCATCGATTTTTCTTAG. Deletion right flank: AAATATATTTAATTGACTCCAATTTTTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1667 F55G7.2(ok2176) X. C. elegans . External left primer: TTTGCACAGTTCGAGGTGAC. External right primer: CCCCGGATGTTCTACTTTGA. Internal left primer: TCACTGCCAGCCAATTAAAA. Internal right primer: CGTTTGAAAGAAAGGGACCA. Internal WT amplicon: 2188 bp. Deletion size: 1425 bp. Deletion left flank: GTTTTGTTTCAACAAGCGATTCTGAGATTA. Deletion right flank: TAACGCAACTGCTTCATTAAATTTTGCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1668 fmo-2(ok2147) IV. C. elegans K08C7.5. External left primer: TGTTCAATGATCGTACCCGA. External right primer: GTTCGAAATTGGGAAATCCA. Internal left primer: CGTGATCAGAGACGACCAAA. Internal right primer: AATGGTCGTTTTACCGCATC. Internal WT amplicon: 2216 bp. Deletion size: 1070 bp. Deletion left flank: GAGAAGAAAAAACGTTGGAAGAAATCTTTG. Deletion right flank: AACGGTGCCAGAAATGCGATTTTGACTATT. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1669 aptf-1(gk794) II. C. elegans K01A1.1. External left primer: CTGTGGGATTTGCAGGACTT. External right primer: CCGGATCGATTGCTAGAGAG. Internal left primer: ACAAACATTGACAGGAGCCC. Internal right primer: CCAATTTCTCGGGAATGAAA. Internal WT amplicon: 2095 bp. Deletion size: 655 bp. Deletion left flank: CAGTGAGCAATTCACAACAGTTCTTCAATG. Deletion right flank: ATTAACGCTCCATAACGCTCGTACTTGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC167 tbb-2(gk130) III. C. elegans C36E8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1670 gpr-1(ok2126) III. C. elegans F22B7.13. External left primer: TAGAAGTTGAGTGCGCGAGA. External right primer: ACAGATCGATGAATGAGCCC. Internal left primer: TCGTGTATTCGTGGAGATCG. Internal right primer: TCTTTTTCGGGAAACAATGC. Internal WT amplicon: 2127 bp. Deletion size: 895 bp. Deletion left flank: GAAATGCTTGTCACTAGACGAAAAATACGA. Deletion right flank: ATCCTCCCTGGACTCCGTGCCAATTGGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1676 Y71H2AM.12(ok1989) III. C. elegans Y71H2AM.12. Superficially wild type. External left primer: GCGAAAAAGGTAACTGCTGG. External right primer: GTTGAGGCCCAAAAATCAAA. Internal left primer: ATGCAGCACCTCCTCGTAAC. Internal right primer: GTTGTGGTTGTTGGGGAATC. Internal WT amplicon: 2336 bp. Deletion size: 1365 bp. Deletion left flank: AATTTCCTGTCACGTACTCATTGCACCACA. Deletion right flank: TCGATTATTCCCTTCCATCGGATCAAATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1679 efl-1(gk790) V/nT1 [qIs51] (IV;V). C. elegans Y102A5C.18. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk790 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. NOTE: Balancer is prone to breaking down. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: TGTCGTTTCCCTTCCTTCAC. External right primer: TAGGCACAGCTTGAACCCTT. Internal left primer: TGGAGCGAAATTGAGGCTAT. Internal right primer: CAGAAAGCTAAGACCTGCGG. Internal WT amplicon: 1986 bp. Deletion size: 671 bp. Deletion left flank: GTGTCAAAAATGAAATTTTCATATGAAAAT. Deletion right flank: CAAAGTCAAGCTCATTGTCGAGCCCGAGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC168 ppt-1(gk134) V. C. elegans F44C4.5. Dpyish. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1680 +/szT1 [lon-2(e678)] I; ham-2(gk780)/szT1 X. C. elegans C07A12.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk780 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGATTATGGGGTCGAATGG. External right primer: TGGAAAGATGGGGCAATTAG. Internal left primer: GGGAGCGAGAGAGAGACAAA. Internal right primer: GCTCCAGTGGGAAATTGAAA. Internal WT amplicon: 2317 bp. Deletion size: 1294 bp. Deletion left flank: AATGCATTGTCCAATCGCTGCTATGTATGC. Deletion right flank: AGAGCCAAAATGACCAACATTATTGACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1681 F13H10.4(ok2135) IV/nT1 [qIs51] (IV;V). C. elegans F13H10.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2135 homozygotes (sterile, oftein with abnormal vulva). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGCATGGACTTGAGGATTGG. External right primer: AATGGTGCCATCTATCAGGC. Internal left primer: TGAGCATCATTGGGAACAAA. Internal right primer: ATAACTCAAAAAGCGCCGAA. Internal WT amplicon: 3344 bp. Deletion size: 1311 bp. Deletion left flank: TTGTATCTGTAATAAAATCGAAAAAGTAAT. Deletion right flank: GAGCATTACAGAATGAGAAGTTTGAAGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1682 T10B10.3(ok2184) X. C. elegans T10B10.3. External left primer: TATGGGGAAAATTGGGACAA. External right primer: TAGACATTTGGGCAATGCAA. Internal left primer: ATCATCATCAAGCTTTGCCC. Internal right primer: ACCGCACAACATATGACGAA. Internal WT amplicon: 2804 bp. Deletion size: 2484 bp. Deletion left flank: AAGCCGTTCCAGCTCCTTATCGAATCGGAC. Deletion right flank: TCACTTTGTTTACATATCCTTCGACCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1684 C34B2.8(ok2168) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C34B2.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2168 homozygotes (mid-larval arrest, thin Unc sometimes with withered tail). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTTTCATTCCACCTTCGGA. External right primer: CATCTGCTCCAACGACTTCA. Internal left primer: AACAACCGCGTCAAAAGTGT. Internal right primer: ATTCGTCTCGATTTGCTGCT. Internal WT amplicon: 2130 bp. Deletion size: 1250 bp. Deletion left flank: GACCCACCGCTCAATTTTTGTTCCTGCGCC. Deletion right flank: TTGAATGCACGATAGCCTCCTTTTGGAGGC. Insertion Sequence: AAAAGTGCGATGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1685 cogc-1(ok2123) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y54E10A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2123 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATTCGCCAAAAGGGTCT. External right primer: AGCAGAAGCTGGAGCACATT. Internal left primer: CTGACAATTTTTGGGCTCGT. Internal right primer: GCCATCGTTTCTTTGAGAGC. Internal WT amplicon: 3367 bp. Deletion size: approximately 1600 bp. Deletion extents narrowed to region between Y54E10A coordinates 80020 and 81877. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1687 unc-39(gk798) V/nT1 [qIs51] (IV;V). C. elegans F56A12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk798 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAGACAAGGATAGCACGCAA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: TTTACGACTTGGCAGCTGGT. Internal WT amplicon: 2117 bp. Deletion size: 1032 bp. Deletion left flank: CGAGGGAAATCAAATATCAGAACTTGAAAA. Deletion right flank: TATCATTCCAATGAATTCGAGACACTCTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1688 sex-1(gk808) X. C. elegans F44A6.2. External left primer: ACCATTCATGCCTACCTTGC. External right primer: GTCATCGCTTCCCAACATCT. Internal left primer: ATCCACTTGCTTTGTCTCCG. Internal right primer: TGGTGAAGTGAGCTCGAGTG. Internal WT amplicon: 2458 bp. Deletion size: 630 bp. Deletion left flank: AACTCAACTTGGCAGATTACAGATTTAACA. Deletion right flank: TCTTAGGTGAGGAAAAAAATCTGTGTTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1689 ces-2(gk1020) I. C. elegans ZK909.4. External left primer: GCTCTGCGTCTCGTTCTCTT. External right primer: TCTACGGGGGTATAGTTGCG. Internal left primer: CACTGTTGCACCCTCTGATG. Internal right primer: TGGGTGGTGCTAAACAATGA. Internal WT amplicon: 1932 bp. Deletion size: 812 bp. Deletion left flank: CCCAAATTATCACAGCAGACGCAATGGACT. Deletion right flank: CCAATTAAGAGCTCTTCGAGATTCGGCTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC169 tbb-2(gk129) III. C. elegans C36E8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1690 unc-85(ok2125) II. C. elegans F10G7.3. External left primer: TTCGAAATCGATTGAAACCC. External right primer: GCTCGAGAGGCTGCTTTAGA. Internal left primer: TCCGTTCGAAATTTCCTGTT. Internal right primer: CCCCGTGTCTTTCATTGATT. Internal WT amplicon: 2106 bp. Deletion size: 1708 bp. Deletion left flank: TGGAAAAATAAATAAATAAATACGAAGAAG. Deletion right flank: AGTAAAGAAATTGATTTAAAAAGAAAATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1691 sea-1(gk799) II. C. elegans F19B10.9. External left primer: ACCGTCACGAATGAGGTTTC. External right primer: CTCTTGCCGACTTCGTTTTC. Internal left primer: TGCCTGAGCAATTTCCTTCT. Internal right primer: TTATATTTGCGGTGCTGTGC. Internal WT amplicon: 2319 bp. Deletion size: 668 bp. Deletion left flank: AGGAAGAGGACGGCCGGGAGGTGGATTGCA. Deletion right flank: ACGCTAAAATTGTCTGGAAAACTGCCAACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1692 nhr-32(gk810) X. C. elegans K08H2.8. External left primer: AACGAGGCATGTTGGTTTTC. External right primer: CACGAGTGATGCGAGAGTGT. Internal left primer: TTGTTAGGGTGATTGGGAGC. Internal right primer: CGGGTGTTGCTATATTGGGT. Internal WT amplicon: 2237 bp. Deletion size: 697 bp. Deletion left flank: GCGACGCGGCGGACGGGTTTCATTACGGTG. Deletion right flank: AGAATGATAACTCGACCATAAAACGTTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1693 C30G4.7(gk806) X. C. elegans C30G4.7. External left primer: TTGGATGGGGATACACCAGT. External right primer: TTTTCCCGGTTCACTTTCAC. Internal left primer: GTCATTGGGAATTGTTCGCT. Internal right primer: GCCAGGTTCGTGAGAGGTAG. Internal WT amplicon: 1951 bp. Deletion size: 857 bp. Deletion left flank: CCTTCTATTTCTGTCTCCCCCCCATAAATA. Deletion right flank: TGCCACATGGTTAGTAAAACTGGGTGGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1694 ZK265(gk815) I. C. elegans ZK265. External left primer: ATTTTGGCGCATATCTCACC. External right primer: AGGGTGCGATTAACGTTTTG. Internal left primer: GCGTTGGTAGGTTGTGTTGA. Internal right primer: GCACTCTGCGGGATTTCTAC. Internal WT amplicon: 2020 bp. Deletion size: 275 bp. Deletion left flank: AAACACAGCGTCTCTTAGAGGCATTTATGT. Deletion right flank: TGTTTTGGCACGCGGCACCTCCAACACAAA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1695 gpla-1(ok2127) V. C. elegans F58H1.4. External left primer: TCGCCATAATCATGCAAAAA. External right primer: TTGCACTATTCCAGTGCTCG. Internal left primer: GATGCCCGTATCAACGAGAT. Internal right primer: ATGTGCCAAAGCATAACACG. Internal WT amplicon: 2318 bp. Deletion size: 979 bp. Deletion left flank: AAATTTAAAGGACACTGATCGAAGTTTAGT. Deletion right flank: CAACTTTCCCTCATGGTACTTGTTCGCTAT. Insertion Sequence: TTCCCTCAGGGTACTTGTT. gpla-1 formerly known as flr-2. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1696 nhr-94(gk805) V. C. elegans C12D5.8. External left primer: AACACCATTCGACGGAACTC. External right primer: ACGTTCTACAACCGGCCATA. Internal left primer: TTCTTCTTGAAGCCAGCGAT. Internal right primer: TGGAGCGCAGTTGTTGATTA. Internal WT amplicon: 1789 bp. Deletion size: 884 bp. Deletion left flank: AATTTCAATTCGAACAATGGATATGCCACG. Deletion right flank: ATTTTACTACCATCAAAACCAGATACCTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1697 mltn-13(gk807) X. C. elegans F15A8.7. External left primer: TTGGGCCTGAGACCTTATTG. External right primer: CCCCCTCAAACTCAAGCATA. Internal left primer: AGCCTGATCCGATTTCAATG. Internal right primer: TCAACTGTGGTCATTTCGGA. Internal WT amplicon: 2295 bp. Deletion size: 960 bp. Deletion left flank: AAAAAATATTCCATTCGAAAGTAATTCGTA. Deletion right flank: ACTCTGAAAAATACATTTACTTAACATTCA. Insertion Sequence: ATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1698 nhr-118(gk3041) V. C. elegans This strain is homozygous for a deletion (gk3041) in F13A2.8, detectable by PCR using the following primers. External left primer: ACTTCATCTGAATCGCCACC. External right primer: AATGGTTTTGACACCGCTTC. Internal left primer: TTATCAGATGCTGGTCCACG. Internal right primer: TGGTTGAAAGTTGGTGTCCA. Internal WT amplicon: 2061 bp. Deletion size: 1081 bp. Deletion left flank: AGCCAGGTTTGCTCAAGGTAAAAAATGCCT. Deletion right flank: TTTTACTCCTTTTTCTACAGTCGTTGTTAT. Validation: gk3041 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1699 Y51H4A.18(gk809) IV. C. elegans Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 265 bp. Deletion left flank: CCAAGGCAGATTTGTGAATGAACTCGGCGA. Deletion right flank: ATTAAAAATGTTTACTTTACTTATTTTATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC170 cki-1(gk132)/mIn1 [dpy-10(e128) mIs14] II. C. elegans T05A6.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk132 homozygotes (embryonic arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1700 +/szT1 [lon-2(e678)] I; asb-2(ok2029)/szT1 X. C. elegans F02E8.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2029 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTCACCTCTTTCCCAATCCA. External right primer: AGGTTTTGTGGCTGACGAAT. Internal left primer: CTAAACGACACTCCGCTGGT. Internal right primer: GCCACAGAAATGTGGCTTTT. Internal WT amplicon: 2129 bp. Deletion size: 1155 bp. Deletion left flank: GACTGCAACAAGGAATGGTCTGCTCCAGAA. Deletion right flank: ACTTTAAATACGAGATGAAAAAAGGACTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1701 mif-1(gk1027) III. C. elegans Y56A3A.3. External left primer: TAAAGCACAAATCCCGGAAG. External right primer: GTTTGACCGTTGTAGGCGAT. Internal left primer: ATGTGCAGCAGAAAGGGAAG. Internal right primer: TTGTCGAATCACACAGGAGG. Internal WT amplicon: 2124 bp. Deletion size: 1620 bp. Deletion left flank: AAAAAAGAGGACGAAAAAAAAGTTTTGAAT. Deletion right flank: AGTAAAAGAATGATGAATTTCTTTTCCGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1702 F42E11(gk844) X. C. elegans F42E11. External left primer: CACGCGTCTCTGAAAAATGA. External right primer: AAGAGCCAGCCTATCGTTCA. Internal left primer: GGCTTCAAACACCTCACCTC. Internal right primer: ATCAAGGGTCACCCAACAGA. Internal WT amplicon: 1609 bp. Deletion size: 419 bp. Deletion left flank: TCTTCTTCATGCATATTGTCTTCTTGCGCA. Deletion right flank: AAAAACTTGTTATAAATTTAAATTTTATGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1703 +/szT1 [lon-2(e678)] I; sex-1(gk829)/szT1 X. C. elegans F44A6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk829 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACCATTCATGCCTACCTTGC. External right primer: GTCATCGCTTCCCAACATCT. Internal left primer: ATCCACTTGCTTTGTCTCCG. Internal right primer: TGGTGAAGTGAGCTCGAGTG. Internal WT amplicon: 2458 bp. Deletion size: 725 bp. Deletion left flank: AGAAATAGACTCCCTAACTTACCACTTGTT. Deletion right flank: CGTGTATTAATCTGCGCTGAATGCCTGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1704 set-26&tsr-25(ok2136) IV/nT1 [qIs51] (IV;V). C. elegans Y51H4A.12 & Y51H4A.15. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2136 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCCATTCCACCAATTCCA. External right primer: TTGAAAAATCGGCTTTCAGG. Internal left primer: ACTCCACTTGATTTCCACCG. Internal right primer: AAATTCCTCGCTTTTCGTCA. Internal WT amplicon: 2473 bp. Deletion size: 1621 bp. Deletion left flank: CTTCTGTCGGGAGAATGATTCGGTCCGCGG. Deletion right flank: CAAATATCCTGTATCACGATTTCGACCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1705 ehbp-1(ok2140) V/nT1 [qIs51] (IV;V). C. elegans F25B3.1. Homozygous lethal/sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2140 homozygotes (late larval or sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGGCAGCTGACTGATACA. External right primer: AACTTCTCACCCGTTGGATG. Internal left primer: AACCTACCGAGAGCGTGAGA. Internal right primer: GCTTTCCGTGAATTTGGTGT. Internal WT amplicon: 3312 bp. Deletion size: 1369 bp. Deletion left flank: AGGAACATCGAAAATCGAAAAAAAAATTCG. Deletion right flank: TACATAACTGAACATTTCCTACTACCATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1706 C38H2.2(ok2175) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C38H2.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2175 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGCTGGTGATATGGCAA. External right primer: GAAAAGGCACAGGGTGTGAT. Internal left primer: TCAGACAACCTACGACGCTG. Internal right primer: AGGGTGGAGAACAGTCATGG. Internal WT amplicon: 2946 bp. Deletion size: 767 bp. Deletion left flank: GCGAAGAAGGTTCGCGTCTTCTGTTGGATT. Deletion right flank: GGTAATTTCAGATTCATTGAAGTAGCGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1707 coel-1(gk1266) X. C. elegans C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 207 bp. Deletion left flank: AAAGACAGCTAGCAGTCACTCAGCTGATCA. Deletion right flank: AGCCAGAGAGCCCTAGAACTTCTTGTGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1709 F35D2.3(ok2163) II. C. elegans F35D2.3. External left primer: TTAAGCTCTTGTTGGCCCTC. External right primer: TCGCTTTTCTCATTCAACCC. Internal left primer: TCGTCTCCTTCTTGAGCCAC. Internal right primer: CTATGCATGCGCAATGATTC. Internal WT amplicon: 2133 bp. Deletion size: 661 bp. Deletion left flank: ATATGGACTATCTGGGGACAGATGTGAAAA. Deletion right flank: CATAAAAGTTTAACATTTTTAGCCCACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC171 smf-2(gk133) X. C. elegans K11G12.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1710 dsh-2(ok2164)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans C27A2.6. Homozygous marginally viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2164 homozygotes (mostly sterile; eggs sometimes hatch into abnormal larvae that may grow to adult and reproduce). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACCAGACCCACTGCTGAG. External right primer: GAAGCTTTGCTCCGTACGAC. Internal left primer: TTCCGTGAGGAAATGGAGAC. Internal right primer: AATTGACCTGACCTTGGCTG. Internal WT amplicon: 2756 bp. Deletion size: 1177 bp. Deletion left flank: CACACTCATCTCCCATGACGTAGTAGCATT. Deletion right flank: TGGAGATATAAAACCTTTATAAAGTTACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1711 fbxa-187(ok2258) V. C. elegans F47H4.7. External left primer: TCAGAGTGAACATTGCGGAG. External right primer: CCGACAATTTCAAATACGCC. Internal left primer: AAACTATCGCGGATGAATGG. Internal right primer: AATTGTTCCAGACGTGCCTC. Internal WT amplicon: 2940 bp. Deletion size: 638 bp. Deletion left flank: TTCAAAAACTGAAAGATAAACAAACCCCCG. Deletion right flank: TTTCCAGAGTTAAATCAAGCCTTCTTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1713 Y41G9A.5(ok2128) X. C. elegans Y41G9A.5. External left primer: TGGGGAATAGTTGCTTGGAG. External right primer: ATTTTGGGTCAGTGAGGCAC. Internal left primer: TGTCTTGTGGAGCGAGAATG. Internal right primer: CAAAAACTTTGAACCGCCAT. Internal WT amplicon: 2468 bp. Deletion size: 1516 bp. Deletion left flank: TACTGTCACTTTTTTATATGATATAGTCTT. Deletion right flank: GACTAAATTTGAAAAATCAGATATCTGCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1714 unc-39(ok2137) V/nT1 [qIs51] (IV;V). C. elegans F56A12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2137 homozygotes (probably most often early larval or embryonic arrest, but occasional homozygotes are seen that are Dpyish, Unc and arrest as mid-stage larvae). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAAAAGTCACGCGAATCTCA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: GCGAAGGAGATTTTGAGCAC. Internal WT amplicon: 3042 bp. Deletion size: 1782 bp. Deletion left flank: TTTTTAAAAACATGTTCAACATGCACATAG. Deletion right flank: GTTTTTTGAAACACTGAAAAAATAAAAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1715 crn-3(ok2269) II. C. elegans C14A4.4. External left primer: TTCCAGATGTCGGTTCATCA. External right primer: GGTTTTTGTTCGTTTTTCGC. Internal left primer: GCTCAGGACAACATTGCAGA. Internal right primer: TTCAAACTTTTGTTGCTGCG. Internal WT amplicon: 2914 bp. Deletion size: 1049 bp. Deletion left flank: GGGATTGTCGGCGAAAGAAAGAAATGATGC. Deletion right flank: TGCTCGACGAAATATAGATGTTTCTGTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1718 K06A9.2(gk821) X. C. elegans K06A9.2. External left primer: CAAAATCCCAGCAATCTGGT. External right primer: GTGGTCTCTCGTCAAGGCTC. Internal left primer: TTAAATCAGGGATTGGCTGC. Internal right primer: TCGCAGTTTAGCATGTCCTG. Internal WT amplicon: 2091 bp. Deletion size: 1502 bp. Deletion left flank: GTCGACAAATTCGGCAAATCGGCAAACTGC. Deletion right flank: ACTCTTTTTACCCAGTAATAACAAAATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1719 ZK1025(gk831) I. C. elegans ZK1025. External left primer: ACAATTTTCGCTCGGATTTG. External right primer: ACAACCCGAAAACTGTCCTG. Internal left primer: AACAGTGCCATTTGCCATTT. Internal right primer: AAGATGGTATCGGGTAGGGC. Internal WT amplicon: 1790 bp. Deletion size: 494 bp. Deletion left flank: TATTAAACTGAACGGGGTTTTTATACATAT. Deletion right flank: GTCTAAAAATATATTATGAAGACTACTGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC172 cep-1(gk138) I. C. elegans F52B5.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1720 rpn-1(ok2259) IV/nT1 [qIs51] (IV;V). C. elegans T22D1.9. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2259 homozygotes (arrest stage/phenotype undetermined). Viable WT non-GFP segregants are not homozygotes but rare recombinants. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTTGACCAACACGAACAGA. External right primer: TGACTGCGCCTTTAAACAAA. Internal left primer: TCAAGCTTCCAGGCTTCATT. Internal right primer: TGGTGGCGACTACTCAACAG. Internal WT amplicon: 2938 bp. Deletion size: 1651 bp. Deletion left flank: TATGAACAAGGGAATAGCCAAAACTCGAGG. Deletion right flank: ATGGCTTGTAAAGTGTTCAATTTCAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1721 Y53C12B(gk1026) II. C. elegans Y53C12B. External left primer: CTTGGCCCTATGGACTGAAA. External right primer: TTTCTTGCCCGATCGTAATC. Internal left primer: AAAGCCTACCCAACGAATGA. Internal right primer: GTGGGTGAATAAGGTCGGTG. Internal WT amplicon: 2086 bp. Deletion size: 620 bp. Deletion left flank: AGTTCGAACAAAACCTATAAAAATTGAGTT. Deletion right flank: GGCTTAACAAAAACTTGAACATTTGATCTG. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1722 dyf-1(gk820) I. C. elegans F54C1.5. External left primer: CACGTGCACCGAATCAATAC. External right primer: TATTGGTCGCGTTCAAACAA. Internal left primer: CGGGTTTCTTTCGTGTTGAT. Internal right primer: ACTCGAGGGAAAGGAAGAGG. Internal WT amplicon: 1849 bp. Deletion size: 1342 bp. Deletion left flank: GCATCGCATTCATTTTGACAAGCTTACACA. Deletion right flank: ATAACTTCAATTGACATATTTTTAATTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1723 Y53C12C.1(gk819) II. C. elegans Y53C12C.1. External left primer: GCATTTGTCTTTCGCCATTT. External right primer: ATCCCTTTTCGGCTCTCATT. Internal left primer: GTGCTTCTGGCAAATTGGTT. Internal right primer: TGATGTGTTGTCGGTGTCCT. Internal WT amplicon: 2021 bp. Deletion size: 754 bp. Deletion left flank: TTATTTAAATCAAAAACAACTGTTTATCAT. Deletion right flank: TATAACCAAATTTAGTTTTAAACATATAAT. Insertion Sequence: GCGCTCTATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1724 nhr-238(gk833) V. C. elegans Y46H3D.7. External left primer: TCTCCGGTCCTTGAAAACTG. External right primer: ATACAAGCCGGGTATTGACG. Internal left primer: GCTCACCGAAATCCCAATAA. Internal right primer: TTGCATGACCAGCAGGAATA. Internal WT amplicon: 1813 bp. Deletion size: 805 bp. Deletion left flank: AAAAATTTCAAAATATTAAGTTTTTAACGT. Deletion right flank: GTAGTTAAAAATTGGCAAACATAGATGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1725 nhr-141(gk842) V. C. elegans F25E5.6. External left primer: TTGAACGCACTTCACCTCAC. External right primer: GCCATTTTTCAAATCCTCCA. Internal left primer: ACCACTCCGGTCAAAGATTG. Internal right primer: GAAACTTCTTGTTCGGCGTC. Internal WT amplicon: 2448 bp. Deletion size: 606 bp. Deletion left flank: GGCGCCTATGAATAAGTAAATTTACTTTGC. Deletion right flank: ATAATTTTGAAAAAAGGAACTTTTTACCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1726 nhr-113(gk834) I. C. elegans ZK1025.9. External left primer: ACATTGGCAAAACGACACAA. External right primer: CTTAGGTAGGCTGAGGTGCG. Internal left primer: TCCTGTCAAATTGCCTACCA. Internal right primer: CTGTCCCATTACGGCTTGAT. Internal WT amplicon: 2090 bp. Deletion size: 541 bp. Deletion left flank: AACGGTCCTTCTGAAGAATGCAGCACAAGC. Deletion right flank: AAAAATATTTTCAGATTTTTCATAATTTTC. Insertion Sequence: AGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1727 nhr-32(gk825) X. C. elegans K08H2.8. External left primer: AACGAGGCATGTTGGTTTTC. External right primer: CACGAGTGATGCGAGAGTGT. Internal left primer: TTGTTAGGGTGATTGGGAGC. Internal right primer: CGGGTGTTGCTATATTGGGT. Internal WT amplicon: 2237 bp. Deletion size: 1208 bp. Deletion left flank: CCCAACATTCATTCTCTGCCTCTCTTTAGT. Deletion right flank: TGCGTTTTTTAGGTAAATTTATGAGGTAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1728 nhr-271(gk832) V. C. elegans T03E6.3. External left primer: TCAAAATCGAATTTCCTGGC. External right primer: ATGGGATTGTGCTTCTCGAC. Internal left primer: TTCCGAATCGGTCATACTCC. Internal right primer: AAGATCTCAACCGCCAGCTA. Internal WT amplicon: 2167 bp. Deletion size: 658 bp. Deletion left flank: TAATGACTGTTAATTTTAACTAACTTTCAA. Deletion right flank: CCGAAATCTGTGAAACACTTTAAAATTACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC173 +/eT1 III; gck-1(gk137)/eT1 V. C. elegans T19A5.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk137 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1730 C36B1.8(ok2141) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C36B1.8. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2141 homozygotes (often sterile or nearly sterile, but a population can be maintained and will starve a plate). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAGGACGGCTGTTCCTAAA. External right primer: CATATTGAGCTGGAGTCGCA. Internal left primer: CGAGTACAGAACCGAGGAGG. Internal right primer: ACAATACGCTCTCCGTTTGG. Internal WT amplicon: 3357 bp. Deletion size: 1835 bp. Deletion left flank: TTCTAGCATCTAAATTTTAACAATTAGATT. Deletion right flank: AAATGTATTTTACAACACAATTTCCCTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1732 let-526(gk816) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C01G8.9. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk816 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk816/hT2[qIs48] but is gk816/hT2.) External left primer: GCCATCACTTTCATCGGATT. External right primer: AATAGACGGCACGTGGAAAC. Internal left primer: ATTCGTTGTTGATAAGCCGC. Internal right primer: ATGACCGATGATGATGACGA. Internal WT amplicon: 1843 bp. Deletion size: 1268 bp. Deletion left flank: AGACATAGACGTCATGCGAAAAATAATATA. Deletion right flank: TCTATATATTCTCCGCGTGGTGGGCTATTT. Insertion Sequence: TATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1733 nekl-2(gk839) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk839 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 506 bp. Deletion left flank: ATTTCTTGCCGTTTCGTTGAAATTGTTAAC. Deletion right flank: TGTGTTATAATCTACTAACTTTATAATTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1734 nhr-141(gk845) V. C. elegans F25E5.6. External left primer: TTGAACGCACTTCACCTCAC. External right primer: GCCATTTTTCAAATCCTCCA. Internal left primer: ACCACTCCGGTCAAAGATTG. Internal right primer: GAAACTTCTTGTTCGGCGTC. Internal WT amplicon: 2448 bp. Deletion size: 1181 bp. Deletion left flank: TCCTTGTCTTGAAGAGTTTCTTCTATTAGA. Deletion right flank: CGAAATGTGGCATAAAACCACGTAACGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1735 tab-1(gk823) II. C. elegans F31E8.3. External left primer: GCACAAGTTGTTGGGGAAGT. External right primer: TTCTTGTGCTTCATTCGTCG. Internal left primer: ATGAGAGGTCGAATTGTGCC. Internal right primer: CAAATTGAGAGCATTTGCCA. Internal WT amplicon: 1727 bp. Deletion size: 310 bp. Deletion left flank: CTTCCGATGCCGTCTGAAGCTCCACCCATT. Deletion right flank: CAAAATTGAATTTAAATATAATTTTTCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1736 unc-55&F55D12.6(gk818) I. C. elegans F55D12.4, F55D12.6. External left primer: TTAAAGGCGCTCACTCGTTT. External right primer: TGAAAATCTGCAATGAAGCG. Internal left primer: CCCAGAGCCCATAAGTCAAA. Internal right primer: GACCACGAAATCCTTGGAAA. Internal WT amplicon: 2403 bp. Deletion size: 1944 bp. Deletion left flank: CAGAAAATCAAATAATGTTCTCATCTCACC. Deletion right flank: GAGAACCTCTCTTTTCTTCTTGGGACCCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1737 F43C11.2(gk3131) II; F13A2.3(gk3132) V; W07E11.1(gk3133) F41G4(gk840) X. C. elegans This strain is homozygous for a deletion (gk840) in F41G4.1, detectable by PCR using the following primers. External left primer: TCGTTCTTTCGTAAAACCCG. External right primer: TTCTGGCTTAAGCTGCCAAT. Internal left primer: GAAGGCAAATTGCTCAGCTC. Internal right primer: TTCAATGTGATCGTCTTCGC. Internal WT amplicon: 1889 bp. Deletion size: 925 bp. Deletion left flank: TGCAGTGTAGAGTCGGGTCAAAAAGACAAG. Deletion right flank: AAGATCAACTACACCAGTCCAATTTTCAAT. Insertion Sequence: ATCAACAAA. Validation: No CGH probes for gk840. Other deletions (gk3131, gk3132, gk3133) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1738 F26H9(ok2199) I. C. elegans F26H9. External left primer: ACAAAAGGACGCATCAAACC. External right primer: TTCATACGGGTGTCTCACGA. Internal left primer: TGGGGGTACTGTGGGATTAC. Internal right primer: CAAAAATGGATGAAAACGGG. Internal WT amplicon: 2181 bp. Deletion size: 582 bp. Deletion left flank: GAGAGTGATCAGAAACGAAAAATTTTTTTT. Deletion right flank: GCGCGTTTTTTTTAAATTTAGCCAAAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1739 szy-4(ok2324)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans C30B5.1, C30B5.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2324 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGGGGTACGGTCGAAAGTCT. External right primer: CCGACTGATCCTTATTCCGA. Internal left primer: AACACAGCGACGTCAGAATG. Internal right primer: GCAAGCATCATCGTCTTCAA. Internal WT amplicon: 2125 bp. Deletion size: 1066 bp. Deletion left flank: TCCAATTCAGATAGCAAACAGTGCATGCTT. Deletion right flank: GGTATCTTTAGTTTTATTTAAAATTTATGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC174 wrn-1(gk99) II. C. elegans F18C5.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1741 spe-11(ok2143) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2143 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1196 bp. Deletion left flank: TCTCCAAACTCACTTATTGGAAAAAGCGTC. Deletion right flank: ATAAGTGAGATATCGGCCAAGCAATAGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1743 ZK1128.2(ok2204) III. C. elegans ZK1128.2. External left primer: GCGGAAACACAGGTCTTCAT. External right primer: ATTCGAATTCAATGTTCCGC. Internal left primer: GCTGCCTGATCTGCATGTTA. Internal right primer: ATCCCTTCCATGGATCTTCC. Internal WT amplicon: 2483 bp. Deletion size: 973 bp. Deletion left flank: ACATATAATATGTGTCGTTTCCTCGTCTAT. Deletion right flank: AATATTTATATGAATATTATACAGCATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1744 F21C3.6(gk1019) I. C. elegans F21C3.6. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: AACAATCAACGGATGAAGGC. Internal left primer: TGATGGCTGACTTTGAGCAT. Internal right primer: GCGTCACTGATTGGTCTGAA. Internal WT amplicon: 1902 bp. Deletion size: 853 bp. Deletion left flank: AGTGAAAGAAAACAAAATTGTGTTTAAAAA. Deletion right flank: AGTGAAAACTACAAGACCAATAAGGGATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1745 +/szT1 [lon-2(e678)] I; ifa-3(ok2180)/szT1 X. C. elegans F52E10.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2180 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTGACACATTCCCCACTG. External right primer: GAGCCGTGTAGCTCGGTTAG. Internal left primer: GGTCATAATGAAATGGCGCT. Internal right primer: CTGGAAATCGTGTGCTCAAA. Internal WT amplicon: 2668 bp. Deletion size: 1567 bp. Deletion left flank: CCGGGTGGAGGATATAGTCGGATGGGAAAG. Deletion right flank: ATCCAGTACTCTTTCCAAATCTCGATTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1747 nhr-201(gk1231) V. C. elegans M02H5.3. Identified by PCR, validated by CGH. External left primer: TTGTTCCCCAGCACTTTAGG. External right primer: CTCCCGAAACACGGCTAATA. Internal left primer: TAGAACCACATGGTTTCGCA. Internal right primer: TTCCGGGTGCGAGTATTTAG. Internal WT amplicon: 1776 bp. Deletion size: 764 bp. Deletion left flank: GCTTTGAAAGTTATTCGGAACATACCACAG. Deletion right flank: CTCCCAAAATTAACCTAAAACTAAAAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1749 ZK185.2(gk828) F55G11.8(gk3130) IV. C. elegans This strain is homozygous for a deletion (gk828) in ZK185.2, detectable by PCR using the following primers. External left primer: AACCAAACGATGTCCCTGAC. External right primer: TCGGAAATGAAAACCCCATA. Internal left primer: TATTAGAGGCATATCGGCGG. Internal right primer: ATCACACCGGCGAGAATTAG. Internal WT amplicon: 1842 bp. Deletion size: 1014 bp. Deletion left flank: TTAAAGAATAAATATTTCATTTGGAAGCTC. Deletion right flank: AGGGGCGCGTTAAGAAATCTTGGGTCTTTA. Validation: No CGH probes for gk828. Other deletion (gk3130) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC175 sod-4(gk101) III. C. elegans F55H2.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1750 Y53H1A.2(gk837) I. C. elegans Y53H1A.2. External left primer: ACACGAAACCTAGTCCACGG. External right primer: ATTCGCATAAAAATGGGCAA. Internal left primer: TGTAGAAACCCATTCGAGGG. Internal right primer: TGAATAAGGCCACTGGGAAA. Internal WT amplicon: 1710 bp. Deletion size: 609 bp. Deletion left flank: TCACCGAAAAATCAATATTCGCCCCCGCAA. Deletion right flank: ACCAAAAAACTGATTTTTCTGCAATTTTTT. Insertion Sequence: AGCCTCACCCAAAACATTTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1751 nhr-246(gk856) V. C. elegans ZK1037.4. External left primer: GGAAGCCGGTAATCAATGAA. External right primer: CTTCCATAGGACTCCCACGA. Internal left primer: GGGAATGTCAAAGAGTCCCA. Internal right primer: CCAAAGATCGCCATGACATA. Internal WT amplicon: 2384 bp. Deletion size: 918 bp. Deletion left flank: GAAACTAATCTGTTTGAAATTTTATAATAT. Deletion right flank: ACAACACATTTTTTAATGGGACCTCTCACA. Insertion Sequence: GTGTTTGAAATTTTATAATATATAATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1752 Y23H5A.2&cars-1(ok2280) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y23H5A.2, Y23H5A.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2280 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCATGGAAAAGATCCGAA. External right primer: TGGAACGGAGGTAAAACGAC. Internal left primer: ACCCCATATCGTGTCAATGG. Internal right primer: ACGGATTCAAGATCTGGTGG. Internal WT amplicon: 2132 bp. Deletion size: 475 bp. Deletion left flank: CAACGCGACCGCCGAAGCCGCACAATTCTG. Deletion right flank: TTCTCCGGATCTCGAAGAAAAACGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1754 nhr-162(gk846) V. C. elegans C33G8.10. External left primer: TGCTTAATCCTCCGATTTGG. External right primer: TCAAACATGCTCCCAACAAA. Internal left primer: TCGCATCTTTGAACCAATCA. Internal right primer: TTGTCTTTGCCCATTTGACA. Internal WT amplicon: 2003 bp. Deletion size: 919 bp. Deletion left flank: ACGAGGTACTATGCGAGCCTAGAATATATG. Deletion right flank: TAAAGTATCAAAGTAAGTACCAAAGTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1755 nhr-168(gk847) V. C. elegans C50B6.8. External left primer: TTTTCCGTTTCTCGCAGAGT. External right primer: CAGGGCGTCAACCATTACTT. Internal left primer: GGTTTCAGAAGTTGCTGGGA. Internal right primer: AAAGATCCGGAAACGTGTTG. Internal WT amplicon: 2267 bp. Deletion size: 837 bp. Deletion left flank: GAATATGCTGGGCCAGTTGGTTTTTTACCA. Deletion right flank: TGCACTCGGATCTGGCAGACAGGAACACTG. Insertion Sequence: CACTCGGCACTCGCACTTTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1756 Y39E4B.5(gk848) III. C. elegans Y39E4B.5. External left primer: AGCAGAAACTGTGCGAACCT. External right primer: CATTCCGAGAACACACATCG. Internal left primer: TAGAGCGAATAAAGCCCGAA. Internal right primer: CTAGAGGCGACGTTTCTTGG. Internal WT amplicon: 2038 bp. Deletion size: 753 bp. Deletion left flank: GAAAATACGATTGCTCTGTTCCAGGTGGAT. Deletion right flank: GGAAGAAAGTTCGGCTACATCGTCTGCGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1757 acc-2(ok2216) IV. C. elegans C53D6.3. External left primer: CGCTCGCCACTTCTTTTAAC. External right primer: ACGAAATCGACATCCACCTC. Internal left primer: TCTCTCACTTCCGCTGACCT. Internal right primer: TTCTTTCAACCAAACGGGTC. Internal WT amplicon: 2756 bp. Deletion size: 1749 bp. Deletion left flank: ATTCTCTTTTTAATTTGACAATCAACAATT. Deletion right flank: AATGTAAGTGTAATAGAATTTCAGAATTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1758 nhr-287(gk1014) IV. C. elegans Y41D4B.20. External left primer: TCTCGTTGCTTCCAAGTGTG. External right primer: AGGTGGCTATTTCGCATGTC. Internal left primer: TGTTGGACGATATGGAGCTG. Internal right primer: CAGCCAATTTCCGAGGTAGA. Internal WT amplicon: 2357 bp. Deletion size: 1043 bp. Deletion left flank: TTTCTTTGTACAAAAACCATCACCAGCCTC. Deletion right flank: GAAATTTTGAACATCGAACCAACTATCCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1759 nhr-95(gk836) V. C. elegans Y39B6A.17. External left primer: CTCAGCCACCTGGTATCCAT. External right primer: AAAATTGCAGGAGAACCGTG. Internal left primer: CAAGACGGCTCCAAATATGC. Internal right primer: CGGAGGGAGCTGTAATCAAA. Internal WT amplicon: 2224 bp. Deletion size: 1000 bp. Deletion left flank: TTTTGACTTAAAACGCTCACAATTTTTCAG. Deletion right flank: TCAAATTTTTCGCTAATTTTTAGCTCAAAA. Insertion Sequence: CTAAATTTTGTTTTCTGTATTCTATTTAGAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC176 exc-7(ok370) II. C. elegans F35H8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1760 nhr-114(gk849) V. C. elegans Y45G5AM.1. External left primer: ACCTTGGGTTCCGGAATATC. External right primer: GAACCAGTCTCTCTCGTGCC. Internal left primer: CGAGCTCGTAAATCGACACA. Internal right primer: GTGGAGAGATCGGATTGGAA. Internal WT amplicon: 2261 bp. Deletion size: 1744 bp. Deletion left flank: TCATTCTTCATGTCTCCTGTATCATAGACA. Deletion right flank: ATCTACGTAGATCAAGCCGAAATGAGAAAC. Insertion Sequence: GGGATAAAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1761 Y51H4A.18(gk850) IV. C. elegans Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 435 bp. Deletion left flank: CTTAAAGTATACGTCGATTCTGAAAATACACTGAAAATGAAAT. Deletion right flank: TACAGGTTGGTACTTCTACTATGAAAAAAT. Insertion Sequence: TTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1762 nhr-113(gk852) I; F44E7.7(gk3134) V. C. elegans This strain is homozygous for a deletion (gk852) in ZK1025.9, detectable by PCR using the following primers. External left primer: ACATTGGCAAAACGACACAA. External right primer: CTTAGGTAGGCTGAGGTGCG. Internal left primer: TCCTGTCAAATTGCCTACCA. Internal right primer: CTGTCCCATTACGGCTTGAT. Internal WT amplicon: 2090 bp. Deletion size: 1150 bp. Deletion left flank: TTAAAAAAATAGAAAAAAAATAGTCAACTA. Deletion right flank: GAAAAGCCTGGAGGTCTACCGTGAACTAGG. Validation: gk852 passed by CGH. Other deletion (gk3134) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1763 F59B2.8(ok2150) III. C. elegans F59B2.8. External left primer: TATTGCCCGTGTGTGTGTTT. External right primer: ACAAGGATGCTTTACCCGTG. Internal left primer: TTCTTCGTCTCCGCACTCTT. Internal right primer: TCTCGTCTCTCACCCGTTCT. Internal WT amplicon: 2249 bp. Deletion size: 1073 bp. Deletion left flank: CTAAAATCTTTTTGGCTTTGGCTACTCCTA. Deletion right flank: CACCAGTGGTAGTTTTGTAATAGGAAACGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1764 F12F6.7(ok2252) IV/nT1 [qIs51] (IV;V). C. elegans F12F6.7. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2252 homozygotes (sterile Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGCCACTTCAGGGAAAG. External right primer: AGACAAGGCTGGTCCTGCTA. Internal left primer: GGCAAACAACAAGGCAATTT. Internal right primer: GATCACGCCAAAGCAAATCT. Internal WT amplicon: 3379 bp. Deletion size: 1510 bp. Deletion left flank: TAGGGTGTTCGTTTTTCGATTTTTTTTTTA. Deletion right flank: ATTTCATTCAGAAGTCCGGGATTAAGTGGA. Insertion Sequence: TTATGCCATTTGAAAGAGCATTTTTTAAATGTTTTTCGATTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1765 rpl-20(ok2256) IV/nT1 [qIs51] (IV;V). C. elegans E04A4.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2256 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCGTAATTTGTTCGCGTT. External right primer: GATTGCTGATAACCCGTCGT. Internal left primer: GTTCCGATTTCTTGGTGCAT. Internal right primer: GAAACATGTGCAAGAGCCATT. Internal WT amplicon: 2463 bp. Deletion size: 1213 bp. Deletion left flank: TAAGAATTAATTTACCTTATCGAAATAGTG. Deletion right flank: TTCTATTACCGTATCCTTCATACACTCGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1766 dyf-6(gk827) X. C. elegans F46F6.4. External left primer: GACTTACCACCGGCTTGTGT. External right primer: TGGATCGAGTCAGTCTCGTG. Internal left primer: GCTTTGTCTTGGAAATGGGA. Internal right primer: TGACGGTAAGGCTACACACG. Internal WT amplicon: 1942 bp. Deletion size: 669 bp. Deletion left flank: AGTGTGTCTGCAGAGGGAAAAGTTATAAAA. Deletion right flank: GAGCCCCACATTATCGTCAATCTAAAATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1767 T24H10.1(gk3023) ldh-1(gk3142) II; gkDf25 V. C. elegans This strain is homozygous for a deletion (gk3023) in T24H10.1, detectable by PCR using the following primers. External left primer: GCACAGAAGGGTAGCTGGAG. External right primer: TTGGCTTCTGGCGTCTACTT. Internal left primer: ATGCGATAAATGGAGATGGC. Internal right primer: ACACGCGGTTATTAAGGTCG. Internal WT amplicon: 2047 bp. Deletion size: 568 bp. Deletion left flank: ATTAATACTCTCCGTCATTCTTTACCTTTT. Deletion right flank: AAATCTGCACAACTTCTACTTTCGGCACTT. Insertion Sequence: CATCTGCACA. Validation: gk3023 passed by CGH. Other deletions (gk3142, gkDf25) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1769 nhr-277(gk853) IV. C. elegans Y94H6A.1. External left primer: TTGTCGGAGAGAAGAGGCAT. External right primer: TCTCGTCGAAATATCCCACC. Internal left primer: CGATTCTGACCCGAAGTGTT. Internal right primer: CTTCCTTCTTCACAATCGGC. Internal WT amplicon: 2016 bp. Deletion size: 1145 bp. Deletion left flank: ATCTCTTTCCACTTTTTTCAGTTCATTATT. Deletion right flank: GTGTGTGGCAACGCTGGTGCCACGTCACAC. Insertion Sequence: GT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC177 syx-4&ant-1.4(ok372)/mIs11 IV. C. elegans T01B11.3, T01B11.4. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs11 homozygotes), and non-GFP sterile ok372 homozygotes. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1770 Y73B6BL.1(ok2308) IV/nT1 [qIs51] (IV;V). C. elegans Y73B6BL.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2308 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCGAGAAGAGTACGCAGC. External right primer: GCATAAAAATTCCTGCCTGC. Internal left primer: CGGAATCCGAAAATGCATAC. Internal right primer: AGCTTTCCCCCGATTGTACT. Internal WT amplicon: 3151 bp. Deletion size: 1058 bp. Deletion left flank: GAAAATAAATTGAAAAATAATTTTTCAGGG. Deletion right flank: TAACAAGTTATAGCCGCAATGAATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1771 apc-1(gk824)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans W10C6.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk824 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TATGTGGAACCGAAGGAAGG. External right primer: CAGGCGTTGTTCTTTCACAA. Internal left primer: GGTCTCAGTCACCGGAGAAG. Internal right primer: ATTCAATGACCAACACGGCT. Internal WT amplicon: 2186 bp. Deletion size: 1963 bp. Deletion left flank: TGGAAGAATGCGGAGACTACACGAAAAAAT. Deletion right flank: AAAGTTATGAATTATCGTGCATTCGAGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807. Formerly known as mat-2.
VC1772 skn-1(ok2315) IV/nT1 [qIs51] (IV;V). C. elegans T19E7.2. Homozygous viable/sickly deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2315 homozygotes (viable, sickly, some eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAAACCGACGTAATGTGGA. External right primer: TTTCACCTCCCACCGTCTAC. Internal left primer: CTCAACTGGGCATCTTCACA. Internal right primer: TTTCAGCCATCTCTCCTCGT. Internal WT amplicon: 2440 bp. Deletion size: 1103 bp. Deletion left flank: TTTTTGTATGTAAATTGCCAATGCCATAAT. Deletion right flank: CTCATAGGGTCGAGAGAAAATGAGAGAGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1774 nekl-2(gk841) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk841 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 354 bp. Deletion left flank: TTCAAATGGACAATTATGAAAAAGTGCGTG. Deletion right flank: TATTGATTCTTTTATTATGGATAATCAACT. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1779 F52H3.2(ok2309) II. C. elegans F52H3.2. External left primer: GCAATGTGCAACAAAATGCT. External right primer: CGATTGAAACCCGTTTTTGT. Internal left primer: CTGCCAGATTTCTTGGTCGT. Internal right primer: ACGCTGTTGATTTTTGCCTT. Internal WT amplicon: 2254 bp. Deletion size: 1310 bp. Deletion left flank: AGATAAAGTCGAAACTCCGCACGAGAAGTT. Deletion right flank: TTTTCAATTTTGTAACCTTTTCCGATTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1780 vps-28(ok2278)/hIn1 [unc-101(sy241)] I. C. elegans Y87G2A.10. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAGACGTTGTGTCTTCCCG. External right primer: CTACAAACCGAGCTGAGCCT. Internal left primer: CCTCACAATTTTGAAACTGCTC. Internal right primer: AATTTCGAGTTTTCGCTTGAA. Internal WT amplicon: 3080 bp. Deletion size: approximately 1600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1782 +/szT1 [lon-2(e678)] I; egl-15(ok2314)/szT1 X. C. elegans F58A3.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2314 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTTGCGCGTGTTTAGTTCTG. External right primer: CAACGCTTCTAAAGCCATCC. Internal left primer: TTTTTGCAGGGTCTTTGGTC. Internal right primer: ACAAGATGGCGTTGTGTCAA. Internal WT amplicon: 2895 bp. Deletion size: 1208 bp. Deletion left flank: GTAGTGCTCGGTCCGGCGGATACGAATTCA. Deletion right flank: TTTTAATTGCGTTTCAGGAAATCGCAGTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1783 F49E12.6(gk835)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F49E12.6. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk835 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 812 bp. Deletion left flank: GGCATAGTTATGGTTTTTCTTATTCTATGT. Deletion right flank: TTTGGGATTGCTCTGTCAAAGATTTCTGAT. Insertion Sequence: TTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1784 str-148(gk3036) II; T28F3.1(gk1230) IV. C. elegans T28F3.1, M01D1.1. The allele gk1230 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CATGGTCAACGAAGCTGAGA. External right primer: GAGAGGCAGAACCGAAGTTG. Internal left primer: TGCGACGAGATCTTGAAGTG. Internal right primer: AAAGCACATTTGGGCAAGAC. Internal WT amplicon: 2703 bp. Deletion size: 1246 bp. Deletion left flank: TTATTCTCTTTTCCCCCAAATCCCCTATAT. Deletion right flank: GGCAAATGGATAGCACGGATCTGAAATTAA. The allele gk3036 was identified by CGH but not confirmed by PCR. Left flanking probe: CTTGTTGCCCATCTCTGATTTACAACTCGGCCCATAGCGTAATTAAAAAT. Right flanking probe: GATATCCCTTCGAGAATAATATCAAAGTTAAATGTATCTTCATGTCGTTG. Left deleted probe: CACTCCAATTTTCCACGAAAATGCTTTGGCTGCATATCATACAATATTCT. Right deleted probe: ACTACCAGTTCACGTGCAGTTTGAGTTTGTTTCATCAAACCCATTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1785 F08A8.1(ok2257) I. C. elegans F08A8.1. External left primer: GAAGCTTGCAGAAATCCCAG. External right primer: GGGGTTATCTCCATCACGAA. Internal left primer: CATCGCCGAACTTTCATTTT. Internal right primer: TGGATGGATGAACTGATGGA. Internal WT amplicon: 3168 bp. Deletion size: 1064 bp. Deletion left flank: GTATGCGTTGAATATTGCAACAAGATACTC. Deletion right flank: CACTGGTAGCCTACTTGGGCGCCAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1787 C17E4.6(ok2296) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C17E4.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2296 homozygotes (viable Unc, sickly, BMD, vulval defects). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACGACCTCTTGGACGAAAT. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGTGCGAGTGCGTTACACTG. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2597 bp. Deletion size: 1233 bp. Deletion left flank: GATGATATTCTAGCTAAGAACAAGAAATGG. Deletion right flank: TCAACGACGACAACTCTACCAGTCAACGTC. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1788 ast-1(ok2359)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2359 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATAGGCCACCAGCTTCTCAA. External right primer: CCCAACTACCAACACAGGCT. Internal left primer: GACAATAGCGAAGAGCCGTC. Internal right primer: TGTGATCAAGTATTCGGCCA. Internal WT amplicon: 2386 bp. Deletion size: 946 bp. Deletion left flank: CACAGATAATAGAGCTTTTTGGAGCAGCAC. Deletion right flank: TTCATCGTCGTCGCCGAATCATCGGCGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1789 nduf-2.2(ok2397) III. C. elegans T26A5.3. External left primer: CGAGCATCTTTTGATGCAGA. External right primer: TGCTGTGGTCCAAAGTTGAG. Internal left primer: CTTTCATGAGCCGAGTCACA. Internal right primer: ATTTGATCGTCGAAATCGGA. Internal WT amplicon: 2684 bp. Deletion size: 910 bp. Deletion left flank: AGTTTCAAAGAGTGGAGGAATGGGTGGCAT. Deletion right flank: ATGCTTTCGCGATCATTGCATCCTCTTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC179 glh-1(gk100) I. C. elegans T21G5.3. Temperature-sensitive sterile. Gives some sterile progeny at 15 degrees. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1790 ech-4(ok2291)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans R06F6.9. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2291 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGGTGAGTTTCGTTGGAAAT. External right primer: AAATGCTGCTCAAAAGCGAT. Internal left primer: ATTTCAGGCGTTCAGGATTG. Internal right primer: AACTTTTGTTGCCCGATTTG. Internal WT amplicon: 2356 bp. Deletion size: 1254 bp. Deletion left flank: GCGCAGAAAAATCTGAAAACTCTGAAGGAA. Deletion right flank: AATATCAACTGCTTTGCTCATCAAGAACTA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1791 ttr-1(ok2250) III. C. elegans K03H1.6. Superficially wild type. External left primer: AATTGGCCGTCTTCAATCAG. External right primer: CCCAGGTGGTAAAATGGATG. Internal left primer: GCGGTGAGATTTTAAAACGG. Internal right primer: GGCATTACCTCGCCAATAGA. Internal WT amplicon: 3092 bp. Deletion size: 1281 bp. Deletion left flank: CAACGTCAACTCCGTGTCGACATTCCAAAA. Deletion right flank: AAAAAATCAATGTTCTTCAGTTTTTTATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1792 C35E7.6(ok2255) I. C. elegans C35E7.6. External left primer: AAAACGGAAACGCAGAAAAA. External right primer: CGATTTATCCGTTAGCCGAA. Internal left primer: ACAGCCCGTCTGAAAGCAT. Internal right primer: CCCTGAATGGAACCTTTTGA. Internal WT amplicon: 3224 bp. Deletion size: 1875 bp. Deletion left flank: TTGGTTCGATTTGAGTGATTTTCTTTAAAA. Deletion right flank: TAAGCTCAAGCTCATAAGTTACTTGTGAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1793 cTe154X.1(gk3143) III; ZK185.2(gk804) IV. C. elegans This strain is homozygous for a deletion (gk804) in ZK185.2, detectable by PCR using the following primers. External left primer: AACCAAACGATGTCCCTGAC. External right primer: TCGGAAATGAAAACCCCATA. Internal left primer: TATTAGAGGCATATCGGCGG. Internal right primer: ATCACACCGGCGAGAATTAG. Internal WT amplicon: 1842 bp. Deletion size: 780 bp. Deletion left flank: ACTTGAATTTTTCCAGTAATTTTAGTTTTG. Deletion right flank: CTCTACCGGAGTTTGAAGGCACTTATTCGT. Validation: No CGH probes for gk804. Other deletion (gk3143) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1794 mop-25.2(ok2073)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Y53C12A.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2073 homozygotes (sterile with very occasional progeny). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATCTGAGCAAGTCGATGG. External right primer: TCTCCTCTGCGATTTTCCTC. Internal left primer: CGGAAAGGGGATGGATATTT. Internal right primer: ACCGGTTTCCCAAATTTTTC. Internal WT amplicon: 2262 bp. Deletion size: 1677 bp. Deletion left flank: TCACAAATGATAATTGTGGTTTTTTTTTGA. Deletion right flank: TTCGATAGCTTTTTCGACTTTCCGCTCACT. Insertion Sequence: TAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1795 nrfl-1(ok2292) IV. C. elegans C01F6.6. External left primer: AATACATCGTTTTCCACGGG. External right primer: GTTAAGGCTCATCTCGTGCC. Internal left primer: CCCAATGTTTCGTCTTTTGG. Internal right primer: AATTTTGTTTTGGAAACAGTGAA. Internal WT amplicon: 3139 bp. Deletion size: 1117 bp. Deletion left flank: GAAATGCAATAATATTCAACAATTATATAT. Deletion right flank: GTAGACGACTATTTAATATTTAAAACTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1796 ZK1127.5&ZK1127.12(ok2279)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans ZK1127.5, ZK1127.12. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2279 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATATGTTGCAAAGGACCGC. External right primer: CTCAGCACCTTCCAATCCTC. Internal left primer: TGAATTCTCACAATGGAGCG. Internal right primer: AAATCTGAGCCGGTCCTGTA. Internal WT amplicon: 3074 bp. Deletion size: 1999 bp. Deletion left flank: TTTAGTTTCTATTTGAGCTCAATCCTCAAA. Deletion right flank: ATCTACGGTAACAGTGTCCGATCTACGGTA. Insertion Sequence: GGAAGTGTGAAACATCTTTAGGACAGAGTGTCATAAATGTGCTTGCAAGTATTTGAGCA CTACTGTCAAGGGCACCTCCCATGTAAATTTGTTGAAGAAGAGCATGACCGGCTTCAAT TCCAATGTCTTCTGGAAGAATTGGAACTCCTGATTCGCCCTTCGGTCTTGAAATAGCTT CTGCTTGGTAGATAACACCCTCTGTCGTTTCGGCGGTTAAGAACAGACCATATCCTGGA GAAGCGCCACCAGCATCACCTTTCCGTTGATCAACAGTAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1797 sft-1(ok2277)/sC1 [dpy-1(s2170)] III. C. elegans H06I04.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2277 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGACAACTCCTTGCCTCACC. External right primer: ATTCCCCGCCATTTATTACC. Internal left primer: CAAACAATCCCAAATTCTCG. Internal right primer: AGCTACAGTAACCCGCGAAA. Internal WT amplicon: 3080 bp. Deletion size: 1808 bp. Deletion left flank: AAAAAAAATTTCTAAATTTATTCCCAATTT. Deletion right flank: TCAAAAAATCAGGGGTTCGTTGTGAAAAAT. Insertion Sequence: TCTTCTAAATTTATTCCCAATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1799 Y53C12B(gk862) II. C. elegans Y53C12B. External left primer: CTTGGCCCTATGGACTGAAA. External right primer: TTTCTTGCCCGATCGTAATC. Internal left primer: AAAGCCTACCCAACGAATGA. Internal right primer: GTGGGTGAATAAGGTCGGTG. Internal WT amplicon: 2086 bp. Deletion size: 501 bp. Deletion left flank: TCGTGTGAGGTCTTCTATCCAATCGCGGGT. Deletion right flank: ATCGATTTTTGTGATTTTATAAAGTTTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC180 +/eT1 III; tnt-4(gk136)/eT1 V. C. elegans T08B1.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk136 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1800 Y53C12C.1(gk851) II. C. elegans Y53C12C.1. External left primer: GCATTTGTCTTTCGCCATTT. External right primer: ATCCCTTTTCGGCTCTCATT. Internal left primer: GTGCTTCTGGCAAATTGGTT. Internal right primer: TGATGTGTTGTCGGTGTCCT. Internal WT amplicon: 2021 bp. Deletion size: 631 bp. Deletion left flank: CGGAGAAATTAACTAAATTTTTAAGATCAA. Deletion right flank: ACCCCACATTGTGTTGAATATATGGCGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1801 cnx-1(ok2234) III. C. elegans ZK632.6. Superficially wild type. External left primer: ACCTCACATGGTGGAAAAGC. External right primer: ACAGACGCGCTCTAGCAAAT. Internal left primer: AGTTGGCTTCACTGGCTCAT. Internal right primer: CACAATGCCCCTCATTTTCT. Internal WT amplicon: 2586 bp. Deletion size: 1412 bp. Deletion left flank: CGTCTTGCGGTTCTGGATTGCTCTGGGAAC. Deletion right flank: GTTAATTGGATTTTTATAACGGAAAATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1803 Y51H4A.18(gk868) IV. C. elegans Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 472 bp. Deletion left flank: AGTCATTGCACAGCTGGAACAGCAACAGAGACTAGAAAAT. Deletion right flank: ATGATTTTTTCTTGGCTTAAACGATAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1804 dyf-6(gk863) X. C. elegans F46F6.4. External left primer: GACTTACCACCGGCTTGTGT. External right primer: TGGATCGAGTCAGTCTCGTG. Internal left primer: GCTTTGTCTTGGAAATGGGA. Internal right primer: TGACGGTAAGGCTACACACG. Internal WT amplicon: 1942 bp. Deletion size: 989 bp. Deletion left flank: TGTCCCTGGAAACCAGAAATTCAGGAGTAG. Deletion right flank: ACAAACTTTAATATCAGAAATCCATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1805 nhr-103(gk864) V. C. elegans F44C8.4. External left primer: ACGCCGGGAAAATTCTACTT. External right primer: GTTGTCGAGAGTTGCGTTCA. Internal left primer: TTACAACATGTTCTGGCGGA. Internal right primer: TCCGATAGCTTATCCAACCG. Internal WT amplicon: 2071 bp. Deletion size: 981 bp. Deletion left flank: TACCTTGCCAATAAAAGTGTAAAACAACAC. Deletion right flank: AAGGTTACTAACTTTTTTGTATTTTTTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1806 nhr-234(gk865) II. C. elegans Y38E10A.18. External left primer: TTACATTGCCTCTGTCTGCG. External right primer: TGGTTTCGAGGAAGTTTTGG. Internal left primer: CAAGGTTCGCGTCTTGAAGT. Internal right primer: ACACCAGCAAATCATCATGC. Internal WT amplicon: 1932 bp. Deletion size: 781 bp. Deletion left flank: CACCCACCCCTGATTGAAATGTCCATTGTC. Deletion right flank: AAAAGGCACCCTCCACTTCGGATCCGTCGT. Insertion Sequence: GGGGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1807 nhr-118&Y47D7A.3(gk811) V. C. elegans F13A2.8, Y47D7A.3. External left primer: ACTTCATCTGAATCGCCACC. External right primer: AATGGTTTTGACACCGCTTC. Internal left primer: TTATCAGATGCTGGTCCACG. Internal right primer: TGGTTGAAAGTTGGTGTCCA. Internal WT amplicon: 2061 bp. Deletion size: 1042 bp. Deletion left flank: AGTCGATTTATTCCTGACCCAAGTGGTATA. Deletion right flank: GCATCCCTTGTTCCATCTCCAAAATTGTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1808 grl-25(gk822) III; daf-3(gk3129) X. C. elegans This strain is homozygous for a deletion (gk822) in ZK634.8, detectable by PCR using the following primers. External left primer: GCATCATTCTTTCAGTCGCA. External right primer: TGAGCTCGACGATGAATCAC. Internal left primer: CCACGTTTCGTCATTCCTCT. Internal right primer: GAGGATTCACCACCTCCTGA. Internal WT amplicon: 1922 bp. Deletion size: 1185 bp. Deletion left flank: GCTGCGGAGGTGGCGGAGGATGTGCTCCAC. Deletion right flank: AAACATATCAACGAAGATTACATTATTCAG. Validation: gk822 passed by CGH. Other deletion (gk3129) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1809 Y48A6B.8(gk813) III. C. elegans Y48A6B.8. External left primer: ACACGTAGGAAACCCGTCAG. External right primer: AATGCTCCATTTTGTGCTCC. Internal left primer: ATCCAGCGTTCAACTGCTTT. Internal right primer: TTTCTGCATACTTTCGGCAA. Internal WT amplicon: 2212 bp. Deletion size: 1719 bp. Deletion left flank: TGGATCTCTGAAAGAGTTCCATTTTCTAAT. Deletion right flank: ATTATAAAAATGTTGAATTTTTTAAATTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC181 nex-4(gk102) V. C. elegans C37H5.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1810 pyr-1(ok2391)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans D2085.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2391 homozygotes (sterile, eggs don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAGCTGAAGAGTTGGG. External right primer: CTCTATTCGCCATCTGAGCC. Internal left primer: AGTTCTTGTCAGAGCCGCAT. Internal right primer: ATTAGCAGGGAAGGCACTCA. Internal WT amplicon: 3370 bp. Deletion size: 2034 bp. Deletion left flank: GGTGTCCGATCATGCTGACGGTTTCTCTCC. Deletion right flank: ATGGCAATTGACAATGGAATTCCCTTGATA. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1811 nhr-21(gk843) gkDf28 II. C. elegans This strain is homozygous for a deletion (gk843) in F21D12.1, detectable by PCR using the following primers. External left primer: CTCTTCTCAGCTCCACCCAC. External right primer: ACCGAGATGCACTTTTTGCT. Internal left primer: ACGCTCTCCGTCTAATCCAA. Internal right primer: ATCACGTGCCTCATTGAGAA. Internal WT amplicon: 2296 bp. Deletion size: 1088 bp. Deletion left flank: AAATTCATATAGTTGAAAAGTTTGTTTCAT. Deletion right flank: AGAGGCGTAACAGAATTATCCGTTGAAACT. Validation: gk843 passed by CGH. Other deletion (gkDf28) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1812 tab-1(gk858) II. C. elegans F31E8.3. External left primer: GCACAAGTTGTTGGGGAAGT. External right primer: TTCTTGTGCTTCATTCGTCG. Internal left primer: ATGAGAGGTCGAATTGTGCC. Internal right primer: CAAATTGAGAGCATTTGCCA. Internal WT amplicon: 1727 bp. Deletion size: 464 bp. Deletion left flank: AAGTGGTTGTTTATTCTTTCATCAACCGCC. Deletion right flank: ATTGAATTTAAATATAATTTTTCCGTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1813 nhr-287(gk866) IV. C. elegans Y41D4B.20. External left primer: TCTCGTTGCTTCCAAGTGTG. External right primer: AGGTGGCTATTTCGCATGTC. Internal left primer: TGTTGGACGATATGGAGCTG. Internal right primer: CAGCCAATTTCCGAGGTAGA. Internal WT amplicon: 2357 bp. Deletion size: 879 bp. Deletion left flank: TCCAGCCCCGAGAAAGCCTAAACTTAAGTA. Deletion right flank: TTTTTTGGGTATGTTCTTTTTGGACCCCCATAACTTTTTTGAGAACAAGTTTCAGATAA TTTTTTTTCGATGAAATTTTAGTCAAATACTTGATTAACATTATCTCCATAAAAAATCA TATTAATAGCTCGTTGGCGCCGTGGGCTGGAACGCGAAAAAAACTTCCCATAATTAATT GTCACCCTGTATATGTATATATGTAATCATATGCACGTATATGTATAATTGATATGTAA TAGATATGTATAACCTATATGTATATAGTAATACATATGTTCAAAACCTAGTAGTATTA TATAAACCTAGTATAGAATATTACCATAACTAGTACCTACCTATGTATATGTATAAAAT ATGATGCCATGATCAGACTGAATGGTAGGTTAATCATCAATCAAAAAATTACTTCAAAA TAATACCCCGGTTTCAGTTATACACCATAACGCCGAATTCAGTAAGCCTATTGTTGGTT TTCGGTAGTTAGTGAATAAACTTATTATTATTATTATTATTATTTGGGTGTATATCTTA TATCATACTATTTTATACATGTTCTTATTAAGGAAAAGGTTTATTTCGTTGCACCTCTG ATTACGGCTCAAAAACCTACCTGTAAATTCGGTAGGATTGACAATATATCCCCTAGTCG AATTGACGAATCTAATTCTGATCTCGTCAGCTTGGAGTACTGTAGAACTTCCCGCTGCA CGGATTCCCGAATCCTTCTGCATGATTCTGTGCATTGATCGGACTGGCCTTCTAGCCCC GTGTCGAATAGAGTTAAGGCTGTTAGAGCCAGAAATTCGAATTTGTCACACGCAATTCG GATCATTGGATCGTACACATTGCGGCGGTAAGTGTCGAATGAGCTGGCGAACATTCTGG AAAATTTTTTAAATCGGCAAAGATATTTGAATAGATTCCTACTTGGAAGCTTCTACCTC GGAAATTGGCTGTTGTCCATCTGGATCGTGATAATACGTTTCTGGATTCACACAATCAA TATAATCACCAGATGGTAGGTAGGTAATGTCTGTTCTGCCATATTGACATGCGAAATAG CCACCTTCGAGGATGATGAATTGTAGGTAGAAGTTGTGGAGCAGGGTTGTCTGAAAGAA TTCGAGGTATGGACTTTGGACAGGGTAAGCATTCTTGGACAGACTCTAAGCAGGCTTTT GCCAAATAACGAGCAGAACTTTACTCGACCAGGCTGGGAAAGATTTGGACCAGAATTGG TCCTGATATTGTTCAACTCTTCGCTTGGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1814 nhr-275(gk867) V. C. elegans Y5H2A.2. External left primer: TCCCAAAAGCTCATGGATTC. External right primer: CAAAGCTGAATGTTGGCTGA. Internal left primer: AAGTTGCCACCAATTTCTGC. Internal right primer: CGTGTCACGCAATGGTTAAG. Internal WT amplicon: 1964 bp. Deletion size: 878 bp. Deletion left flank: GGCAAATCGGCAAATTGCCGAAAAATAAAA. Deletion right flank: TAAAAAATACTTTACAATTTTAAATTTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1815 spr-1(ok2144) V. C. elegans D1014.8. External left primer: CCGAGGTGAACTTCTGGAAA. External right primer: AGGCTTCATGCAGCTTGTTT. Internal left primer: CAGAAACCAGGAACTGGGAA. Internal right primer: GTAGTACATTGGGGCGCATT. Internal WT amplicon: 2700 bp. Deletion size: 1466 bp. Deletion left flank: ACGAGGTACTCCCGTTTGGTTGAAATAAAT. Deletion right flank: ATGATATTAGGCGTTTGGATACTGAACGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1818 T04A8.3&tag-243(ok1855) III. C. elegans T04A8.4, T04A8.3. Superficially wild type. External left primer: CCTTGAACACCCTTCGAAAA. External right primer: TCTGGGAGTCGTTCCAAAAC. Internal left primer: AGCGGATTCCAAAATCATCA. Internal right primer: GTCAGCTGGTCTCGTTGTGA. Internal WT amplicon: 2106 bp. Deletion size: 1416 bp. Deletion left flank: TCTGTACCTTGTATCCATTTCTGGCACGAT. Deletion right flank: GCCTGAAAATTCAGTTAATTTAGACTTTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1819 slo-2(ok2214) X. C. elegans F08B12.3. External left primer: CCGAAGTTAAATATCCGCCA. External right primer: AAGGACCCCAATTTTCCACT. Internal left primer: ATGAACGGCATATGAGAGCC. Internal right primer: TCGCCAGAAAATTGAAAACA. Internal WT amplicon: 3098 bp. Deletion size: 1008 bp. Deletion left flank: TAAATCATGCACTGGTCTGTAGTATGCTCG. Deletion right flank: CTTCTGAAAGAATGTATGTAATCATCGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC182 fut-3(gk103) II. C. elegans F59E12.13. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1821 K06A9.2(gk861) X. C. elegans K06A9.2. External left primer: CAAAATCCCAGCAATCTGGT. External right primer: GTGGTCTCTCGTCAAGGCTC. Internal left primer: TTAAATCAGGGATTGGCTGC. Internal right primer: TCGCAGTTTAGCATGTCCTG. Internal WT amplicon: 2091 bp. Deletion size: 1007 bp. Deletion left flank: GAAATCAAGGTTTTGTGTATCAAATCCAAA. Deletion right flank: AACTGAAAACGTACGTCCGGAATTTCAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1823 nhr-275(gk860) V. C. elegans Y5H2A.2. External left primer: TCCCAAAAGCTCATGGATTC. External right primer: CAAAGCTGAATGTTGGCTGA. Internal left primer: AAGTTGCCACCAATTTCTGC. Internal right primer: CGTGTCACGCAATGGTTAAG. Internal WT amplicon: 1964 bp. Deletion size: 337 bp. Deletion left flank: TGCCAATTTGCCGATTTGCCGGAAATTTCA. Deletion right flank: CCTGAAAAACGCCGCACAGGCTCGGCATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1825 F44E2.8&F44E2.9(ok2134) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F44E2.8, F44E2.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2134 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCTGGTTGGTTTCACCAT. External right primer: ATATGTGGAACTTGCCGGAG. Internal left primer: CATTGGAGAGAGCTTAGGCG. Internal right primer: TCGTTTTTAAATTTCCGCCA. Internal WT amplicon: 2111 bp. Deletion size: 1195 bp. Deletion left flank: TTTTTGTCGAACTTCATTCTTTACTTTACT. Deletion right flank: GGAAATAAAATCGATAAAAACTTTAAAATT. Insertion Sequence: CACGACTTCCTGTTTCTTCAGAAAAACTCTGAATGGCCGTTTCCCATTTTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1827 rbc-2(ok2313)/sC1 [dpy-1(s2170)] III. C. elegans Y54F10AM.10. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2313 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGGTTGGCGACTTTTCAC. External right primer: AGGGGGAACTGTCGGTTAGT. Internal left primer: TACAAATCCCCGTCCCAATA. Internal right primer: AGAAGTCGAGGTGGCAGGTA. Internal WT amplicon: 3304 bp. Deletion size: 2261 bp. Deletion left flank: GCGATAATTTGTTGTTTTTACTGAAAATTT. Deletion right flank: TCGAGGGTGGCTACTGTATTCTCGCGGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1828 tag-164&abcf-2(ok2388) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y76A2A.1, T27E9.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2388 homozygotes (small, sickly, tends to die out but populations are possible to maintain). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGCAGTTGATAGCCTCG. External right primer: CGTCGCTTTTTCCGTGTATT. Internal left primer: ATAGCTGTTTCATCGGGCAC. Internal right primer: AATTTAGGGTACCCCATCCG. Internal WT amplicon: 3031 bp. Deletion size: 1245 bp. Deletion left flank: CAGGCTAAATTAGCATATTTACACAGACGA. Deletion right flank: CCGCTTGAAGAGCAGTTTTCTCTGAAGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1829 +/szT1 [lon-2(e678)] I; lpr-3(ok2351)/szT1 X. C. elegans W04G3.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2351 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACCTGACCGAATGGAAGTG. External right primer: TGCCTGTGTGTTCCATGTTT. Internal left primer: CAATGCGAATTTGTATTTCCG. Internal right primer: TGAGTAATTAGGGCACGGTGT. Internal WT amplicon: 3060 bp. Deletion size: 1878 bp. Deletion left flank: CAAAACCAGCTTATCAAATTCTTTGGACTT. Deletion right flank: ACAACGCATTGAACCCCACTTAAAAAGGGT. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC183 ppt-1(gk139) V. C. elegans F44C4.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1830 rho-1(ok2418) IV/nT1 [qIs51] (IV;V). C. elegans Y51H4A.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2418 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGGAGAGGAGATGTGTGAT. External right primer: GCAAATCCAGGTTTTTCCCT. Internal left primer: ATTGGAATAGAGAAGCGCGA. Internal right primer: TTTTCACCCGAAAATCCAGA. Internal WT amplicon: 3317 bp. Deletion size: 2091 bp. Deletion left flank: ATTTGGGGGAAAATTAGATGAACTTTTGTT. Deletion right flank: AAAAAACTTAAATTTTCAGCAAAAATTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1831 vha-16(ok2332) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C30F8.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2332 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGATCCAGGAAGGAATGA. External right primer: CGAAAATAATTGCAGCCCAT. Internal left primer: TTGCGAAGCCGATTTAGTTT. Internal right primer: TTCTTTCGCCTCCTTTTTCA. Internal WT amplicon: 2112 bp. Deletion size: 831 bp. Deletion left flank: TTTCGAAAAACCAGGCCGTAAACTGACAGC. Deletion right flank: TTTTTTTTCAAATTAAATTATTATACAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1832 ifb-2(ok2420)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F10C1.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2420 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTGCTCCTGCTTTGCAT. External right primer: CCGAGTTATCGTGACCCACT. Internal left primer: AGCAGTGGGAGTGCAAGACT. Internal right primer: ACGTCGAATGATTTTGGGAG. Internal WT amplicon: 3175 bp. Deletion size: 2459 bp. Deletion left flank: TGAGGATCGTAACAAGGAGCTTGTGATTGA. Deletion right flank: ACCACCAGACTCAATTGTGATGGAATCTCA. Insertion Sequence: TATTGAAAACTTTTCAGGGTGATATTCCCAGTCTTCTTCAACAAGCTTCACCTCCAGGA GGAGTTAAATCTCCATCAGCTGTAGTATTTCCGCCTGTTTCCGCAGCTGTCGCTGCAAT CACTGAAATTTCTCCACAAAGTAGCTACTCATCAATTGTGCCAAAAGTGGAAACCGATC AAATCTCCCAACAACTATTTAAATGTTAGTTTTTTATGCGATACAATTATTGCATCAAA CTAATTTTCTCATGTTTCCAGCTCTTCCTTTGTGGTCATTCCAACAAACTCCTGGATTA CCTATCGGAATGGATCTATCACAACTTGTTTTCCAACAATCCTCTCCCGACAAAACAGT TTCACCTGTGAAATCAGAAGTTGTAGAAGAAACGAAACCAATCGCTTCTTCACAATTAA CACTTCACAGCTTCTCCGCATATGTCAAATGTAATAAGACAAGTTTAAGGACAGAACTC GTGAAGATTGAGAATACACTGGAAAAAGATGATATTGACATTTCTGTATTTTACGAAAA ATATCCGAAATTACTTCGAGAATTGTTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1833 sem-2(ok2422) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C32E12.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2422 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGAATGAAAACTGGCTCG. External right primer: ATATGATGCCGCCGATTAAC. Internal left primer: CAATCGCTTGGATTTGTTGA. Internal right primer: CAATTGCAGTAGCCTCATCG. Internal WT amplicon: 3044 bp. Deletion size: 2389 bp. Deletion left flank: AAGTTGGTGCTGGTGATGGTGCGAAGTGGT. Deletion right flank: CCAGAAGTCGATGAGGCTACTGCAATTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1834 C25H3.8(ok2438)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans C25H3.8. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2438 homozygotes (sterile, lays no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCATCAGCTTCAACAACGA. External right primer: TGAAGCTTGGATGGTGTTCA. Internal left primer: CTTCCATCAGGCATCCAAGT. Internal right primer: CAAAGATGCTCGTGCTTTGA. Internal WT amplicon: 2972 bp. Deletion size: 1859 bp. Deletion left flank: CAAATTTTCAATTCTGATTGGTGGTGGATA. Deletion right flank: GAAGTTTGGTATTCCATTGAATCGATTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1835 T28D6.6&pen-2(ok2449) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T28D6.9, T28D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2449 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTCGTTTCTCGCTTTTT. External right primer: CTACGTGGAAACCGTGGAGT. Internal left primer: CCCGTGTGCCTGTAAGTTTT. Internal right primer: CTTAAAGGCGCATATCCCAA. Internal WT amplicon: 2150 bp. Deletion size: 1227 bp. Deletion left flank: TCCAGATATTGCCATAAATTTAGAGAAAAT. Deletion right flank: TTCGATTTTTTTCTGAAAAATTCAAAAATT. Insertion Sequence: ATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1836 cha-1(ok2253) IV/nT1 [qIs51] (IV;V). C. elegans ZC416.8b. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2253 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGACTGACACGCCAATTTTT. External right primer: TGCAATGGCCAAAATGACTA. Internal left primer: CGAGCTCATCGAAAACTTCC. Internal right primer: CCCAAGCCTAAGCCTAAACC. Internal WT amplicon: 2862 bp. Deletion size: 1712 bp. Deletion left flank: ACCGTATATCTACAGTACCCCTACATCACT. Deletion right flank: TGCAAAATATTTCTGTGAGAGGTAATTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1839 T18D3(gk830) X. C. elegans T18D3.7. External left primer: GACCCAGAAACAGCAGTGGT. External right primer: TGTTTGGGTTTTGCTTTTCC. Internal left primer: CCTTTCAATTGCCCTCAAAC. Internal right primer: GCATTGAGCTGAAACACGAA. Internal WT amplicon: 2257 bp. Deletion size: 1248 bp. Deletion left flank: ACTCGGCATCTGGGAGGAAAAGCGTTAAGA. Deletion right flank: GTCATTTTTTGTGCCGCTATAACTTTTTTT. Insertion Sequence: AAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC184 ppt-1(gk140) V. C. elegans F44C4.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1841 ins-3(ok2478) II. C. elegans ZK75.3. External left primer: AACTCCAACTCCAAACCGTG. External right primer: GGAGGCTCTTTACTCGCCTT. Internal left primer: GTCCAGAAACGTCTATGCGG. Internal right primer: TTCAATTCTTTGAGGTTCTAGCAAT. Internal WT amplicon: 3169 bp. Deletion size: 1449 bp. Deletion left flank: ACTATCATTAACTTTTCAAAATGTTAGTTT. Deletion right flank: AATAATGAAAAGTGCAAGAACAACGGAGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1843 Y48A6B.8(gk895) III. C. elegans Y48A6B.8. External left primer: ACACGTAGGAAACCCGTCAG. External right primer: AATGCTCCATTTTGTGCTCC. Internal left primer: ATCCAGCGTTCAACTGCTTT. Internal right primer: TTTCTGCATACTTTCGGCAA. Internal WT amplicon: 2212 bp. Deletion size: 653 bp. Deletion left flank: TTATAGTGTTCTCTCCAGAATAAAAGTTTT. Deletion right flank: GTATCAGAATATCTAAAGTTGGGTGAAACT. Insertion Sequence: TC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1844 pde-1(gk906) I. C. elegans T04D3.3. External left primer: GAATGATGTGGCGCTAGGAT. External right primer: AAATATCCCCCAAAGGCAAC. Internal left primer: TCTGCGTCTCTCTCCCTCTC. Internal right primer: GATACATGGGCCAAGACACC. Internal WT amplicon: 1592 bp. Deletion size: 697 bp. Deletion left flank: CTCTAGAGAAATGGCTCCAAAACACTATAT. Deletion right flank: CTAAGCCTAAGCTTACGCCTAACTCTAAGC. Insertion Sequence: GTATATAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1845 nhr-230(gk898) V. C. elegans Y17D7A.1. External left primer: TTTCCTACGTCACACACCCA. External right primer: AAAAATTACACAGTGCGGGC. Internal left primer: GCATCCAAGCTTCTTCCAAC. Internal right primer: TAGTGCTAATCGGGTCCCTG. Internal WT amplicon: 2252 bp. Deletion size: 1576 bp. Deletion left flank: ATTTGTGCTGTGTGCTCACAGCCGGCACGT. Deletion right flank: ACTAAGCTCACAAATGTCCCAAACGTAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1846 abcf-3(ok2237) III. C. elegans F42A10.1. External left primer: TCCGGTTTTCATCGTCTTTC. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: TATCTCACGGCCACTTTTCC. Internal right primer: AACCGAATGCGAAACAAAAC. Internal WT amplicon: 2429 bp. Deletion size: 1913 bp. Deletion left flank: ATCTTTGCGAGGTTGGAGCTAAGAATGCTT. Deletion right flank: TTTTCAAAAAATATTCATTTTTTCCTAGAA. Insertion Sequence: TTTTTTCAAAAAATATTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1847 T28D6.6&pen-2(ok2395) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T28D6.9, T28D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2395 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTCGTTTCTCGCTTTTT. External right primer: CTACGTGGAAACCGTGGAGT. Internal left primer: CCCGTGTGCCTGTAAGTTTT. Internal right primer: CTTAAAGGCGCATATCCCAA. Internal WT amplicon: 2150 bp. Deletion size: 832 bp. Deletion left flank: CGGCCTCGATATCCGCGATTTTTTGCAAAA. Deletion right flank: GATTTTTTTCTGAAAAATTCAAAAATTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1848 mom-5(gk812) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T23D8.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk812 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTGTGTGCTCCGTTCTCTC. External right primer: AATCGGTCGAACTGGATACG. Internal left primer: GCACTTGGAACCAATGTCAA. Internal right primer: AATGAACATTCAGGAAGGCG. Internal WT amplicon: 1742 bp. Deletion size: 567 bp. Deletion left flank: TTTTAGCTATTTACTTAAGTTCGGTTTTTT. Deletion right flank: AAAAGTTTGGATTTCAATGGCCAGATCAAT. Insertion Sequence: GAAAAAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC185 dpy-10(gk24) wrn-1(gk116)/mIn1 [dpy-10(e128) mIs14] II. C. elegans F18C5.2. Homozygous lethal deletion chromosome linked to dpy-10 mutation, balanced by GFP- and dpy-10-marked inversion. Heterozygotes are Dpy with relatively dim GFP expression in pharynx, and segregates Dpy dim GFP, Dpy bright GFP (mIn1 homozygotes) and gk116 homozygotes (embryonic/early larval arrest). Nature of dpy-10 lesion unknown; recessive lethality could be the result of this mutation. Pick Dpy dim GFP+ and check for correct segregation of progeny to maintain." Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1853 dre-1(gk857) V/nT1 [qIs51] (IV;V). C. elegans K04A8.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk857 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCATTTGTTGAGCCTGCTG. External right primer: ACGCTGAGAGTAAGTGCGGT. Internal left primer: TCAGTGAATGTCAATGCGGT. Internal right primer: CCCGATCATTCTCAACCATT. Internal WT amplicon: 2234 bp. Deletion size: 1021 bp. Deletion left flank: TGAAAACACTTTGAGAAGAAGTTCTTCGGG. Deletion right flank: TAGATGGTGGCAGATTCCGAATAGCTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1855 mbtr-1(ok2465) I. C. elegans Y48G1A.6. External left primer: GCCGACAGGATGCATAAAAT. External right primer: CCCTGCTGGTTTCATATGCT. Internal left primer: GGATTCATCGTCCGATTCTG. Internal right primer: GCCAACAGAGGAGATTCTGG. Internal WT amplicon: 1178 bp. Deletion size: 722 bp. Deletion left flank: AATCCATTAATCATTGCAAATCCGACTGGA. Deletion right flank: TTTTTTCACATTCTCCACCAGAAAAAACAT. Insertion Sequence: TTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1856 pde-1(gk891) I. C. elegans T04D3.3. External left primer: GAATGATGTGGCGCTAGGAT. External right primer: AAATATCCCCCAAAGGCAAC. Internal left primer: TCTGCGTCTCTCTCCCTCTC. Internal right primer: GATACATGGGCCAAGACACC. Internal WT amplicon: 1592 bp. Deletion size: 778 bp. Deletion left flank: CACAAGTTGAGAAGCATCTCTGATTGACTT. Deletion right flank: CGGAAATAAAGTTTTAGATAATTTGAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1857 ces-2(gk892) I. C. elegans ZK909.4. External left primer: GCTCTGCGTCTCGTTCTCTT. External right primer: TCTACGGGGGTATAGTTGCG. Internal left primer: CACTGTTGCACCCTCTGATG. Internal right primer: TGGGTGGTGCTAAACAATGA. Internal WT amplicon: 1932 bp. Deletion size: 651 bp. Deletion left flank: TCGGAAGTTTAAACTGAAAATCAAACATTT. Deletion right flank: GATGGTTTATGGGTGTCAGAATTTTTGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1858 lin-39(gk893) III. C. elegans C07H6.7. External left primer: GGACCCGAAATGTTTCAAGA. External right primer: CCGTTATTCTGCCGATCATT. Internal left primer: TCAGCGCTTTGCAGAAACTA. Internal right primer: CGAAATTGCTGAGTTCGTCA. Internal WT amplicon: 1900 bp. Deletion size: 1206 bp. Deletion left flank: GGAGCTTCCTAACTATAACGCTCCAACTCT. Deletion right flank: GCATTCATCAAAAGGAATTAGATCAACCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1859 Y67D8B.2(gk894) IV. C. elegans Y67D8B.2. External left primer: GGAAAAGCAGACAACCTTGC. External right primer: AAGCCTGCCTAACGACTTGA. Internal left primer: GAGATTCCAGCAAGCCACTC. Internal right primer: GGGTGCCACTAATCGCTAAA. Internal WT amplicon: 1761 bp. Deletion size: 485 bp. Deletion left flank: CATTTGGGTCGAGGCTACTGGATTCATCTG. Deletion right flank: CCTATATGCCTACGTGTTAGGTCGGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC186 smo-1(ok359)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans K12C11.2. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous ok359 hermaphrodites (sterile with one or more vulval blips). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1860 nhr-262(gk897) V. C. elegans F09C6.8. External left primer: ATTTGCCGCGATTAACGTAG. External right primer: GATTTGCCCATTCTGTTGCT. Internal left primer: GACAAGCATTCTCTGCGTGA. Internal right primer: TTTCAGGCAAAGTTTGAGCA. Internal WT amplicon: 2373 bp. Deletion size: 2158 bp. Deletion left flank: TCTGCGTGATCTTTCGTGTGCAAACTGTGA. Deletion right flank: AACATATAAATTTTCCGCCAAAAATTTTCT. Insertion Sequence: ATTTTCCGCCAAAAAACTGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1862 F17C11.9(ok2464) V/nT1 [qIs51] (IV;V). C. elegans F17C11.9. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2464 homozygotes (sterile Dpy). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCTCGCCAACAAGACTGT. External right primer: TCCGAAAAGAATCATGGAGG. Internal left primer: ATTTCAGACCCCAGCATTTG. Internal right primer: TACAGCTCATGAAGGCGAGA. Internal WT amplicon: 1152 bp. Deletion size: 357 bp. Deletion left flank: AACGTTTTTCATGGGACTGAGAGTTGGAAA. Deletion right flank: ACCAAGGCTATCCCACACTTCTGGGAGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1863 ZK418.9(ok2248) III. C. elegans ZK418.9. External left primer: AATACTTCGTCGCAGTGCCT. External right primer: ACTGCCAATTTTTCGAATGG. Internal left primer: AAACGAGATCGGCACAATTC. Internal right primer: TGGTGGCATTGGAACACTAA. Internal WT amplicon: 2302 bp. Deletion size: 966 bp. Deletion left flank: ACACTGGCTTGTGGTTGTTGCATAGGATTC. Deletion right flank: GAAGTGGCTTCGGCTGGCCAGTTGCAGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1864 Y49E10(ok2316) III. C. elegans Y49E10. External left primer: ACCGCACCACATATGATTGA. External right primer: GTCGTCGTCGGAACACATAA. Internal left primer: AATGCGCGCGCTTAGTAG. Internal right primer: TCACCTGTTTTAGGCATTTTCA. Internal WT amplicon: 3186 bp. Deletion size: 1053 bp. Deletion left flank: TCGAGAGTACAAAATAAGCCTGTGGAAAAA. Deletion right flank: TCCAGATCTAAATAAAGGTTTATAACAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1865 ZK265(gk3042) I. C. elegans This strain is homozygous for a deletion (gk3042) in ZK265, detectable by PCR using the following primers. External left primer: ATTTTGGCGCATATCTCACC. External right primer: AGGGTGCGATTAACGTTTTG. Internal left primer: GCGTTGGTAGGTTGTGTTGA. Internal right primer: GCACTCTGCGGGATTTCTAC. Internal WT amplicon: 2020 bp. Deletion size: 1123 bp. Deletion left flank: AAGAAGAACTGTGTGATGGGAAGCAGCAAA. Deletion right flank: AGACACTTGTGGATTCCTCGAGAAAAAGTG. Validation: No CGH probes for gk3042. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1867 T24A6(gk1030) V. C. elegans T24A6. External left primer: AGGAGGAACTCCTCATCGGT. External right primer: CTGTCCTCGCACAAAATCAA. Internal left primer: GGAGTGGTCAAACGGTCATT. Internal right primer: TTCCAGGCTACCCAAATAGC. Internal WT amplicon: 2157 bp. Deletion size: 185 bp. Deletion left flank: ATAAAACTAAACTTTTGTGTAAATAATACA. Deletion right flank: AATTGGGATATGTTAATGGTGGCGCTACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1868 F39H11.1(ok2247) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F39H11.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2247 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACTTCGTCGTGAGCATTCA. External right primer: ATTCTTAACCGTGCGACACC. Internal left primer: CATCATAAAGCATGTGCGCT. Internal right primer: TGTCGCTGCTCAGAAGAAGA. Internal WT amplicon: 2222 bp. Deletion size: approximately 400 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC187 ZK1290.13(gk104) II. C. elegans ZK1290.13. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1872 W07G4.4(ok1223) V. C. elegans W07G4.4. External left primer: TAGCCTGCCATCTCTTTTGC. External right primer: GGGGCGAATGATAAGAAACA. Internal left primer: CTTTTGATGCTGTCGTGCTC. Internal right primer: AAACGTGAGGAAGCACAAGG. Internal WT amplicon: 2105 bp. Deletion size: 1522 bp. Deletion left flank: AAACGTGCGGAGGAAAGCATAGATCAGCAT. Deletion right flank: CCATCAGTTAGCTTCCCTAATCCACTTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1873 rad-51(ok2218) IV/nT1 [qIs51] (IV;V). C. elegans Y43C5A.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2218 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTACCTCATTCTTGGCCG. External right primer: GTTCCTATCGGTGCCTTTCA. Internal left primer: TGAATCCGTGAAAGTGTGGA. Internal right primer: AGGACTTGGCACGTGTCTCT. Internal WT amplicon: 2435 bp. Deletion size: 1634 bp. Deletion left flank: AACGAACGGCTAGTCCTCGCGTGCGTCCTC. Deletion right flank: TGATACTTTCAATTCAATTAATTGGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1874 mes-4(ok2326) V/nT1 [qIs51] (IV;V). C. elegans Y2H9A.1. Homozygous maternal effect sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2326 homozygotes (maternal effect sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTTCTTGCGGTTTTTCGTG. External right primer: TTCCAGCTACCTTCACCCAC. Internal left primer: GGTGTCGGCTACAGGTTGAT. Internal right primer: GCCACGAAAGTTTCTGAGTG. Internal WT amplicon: 3258 bp. Deletion size: 1596 bp. Deletion left flank: TCTGAAAATGACAATTGGCAAAATATAAAA. Deletion right flank: AAATTATCATTTCGAACTTCTCCACTTTCC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1875 dnc-2(ok2249) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C28H8.12. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2249 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACTGACCCGATTTCTTG. External right primer: AACAATCGAACGTTTTTGCC. Internal left primer: AAATGTGATAGTCCACCGGC. Internal right primer: CCGGTAGAGCGCAGTAACTC. Internal WT amplicon: 1224 bp. Deletion size: 707 bp. Deletion left flank: TCAAGTTTGGTAAGCATCATATTCAAACGT. Deletion right flank: TTTTCAGGTTCACTTTTTTGAACTTGACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1876 C39D10.3(ok2179) X. C. elegans C39D10.3. External left primer: ACCCAAACATGTGGGACCTA. External right primer: TTGAACATTGCGATTTCGTC. Internal left primer: TTTGTCTCGAGAGCGCATTA. Internal right primer: AAATGACAACCTGGAGTCCG. Internal WT amplicon: 2866 bp. Deletion size: 1925 bp. Deletion left flank: TTAAAATTGAAAACTTTCAGCTTTGACTTT. Deletion right flank: AATACAATTAGAATTTCAGGTTGTTTATGT. Insertion Sequence: TGTACATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1877 clc-4(ok2507) X. C. elegans T05A10.2. External left primer: GCTTGAGGAGAAGGTGTTGC. External right primer: ATTCCAATCACCCAATCCAA. Internal left primer: CGCTCTTTCTGGTCCATCAT. Internal right primer: TAAGCAAGAAACTGTCCGCC. Internal WT amplicon: 2157 bp. Deletion size: 1046 bp. Deletion left flank: AAAACTCCAATGGCAACAGTCAGAAAAATT. Deletion right flank: TTTAACAACACTTTTTTAAAGTTTAATTTT. Insertion Sequence: ACAACACTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1878 lpd-3(ok2138) I. C. elegans Y47G6A.23. External left primer: AAGAAGCTGCTGGCCAATAA. External right primer: TGGAACTCTTCCAATTTCCG. Internal left primer: TGTTTCGGTCTAAACGAGGC. Internal right primer: TCAGTGAAGTGGCGATTGAG. Internal WT amplicon: 3251 bp. Deletion size: 1913 bp. Deletion left flank: GACTGTTGGGTTACTGTAGTGGTATTGTGG. Deletion right flank: AGTACCCTTTAAAGGTGCACGCCTTTTTTC. Insertion Sequence: GAGTAATTCTTTTTTTTTCGCGTAGCCAACAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC188 acr-12(ok367) X. C. elegans R01E6.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1880 C06E2.1(ok2451) X. C. elegans C06E2.1. External left primer: ACATTTCCTAGCGCGTCATT. External right primer: GGTCAACTTTTCCGGTGAGA. Internal left primer: TTTAACAGCAGCAGCGGAC. Internal right primer: CTGTGACAAATGCTCACGCT. Internal WT amplicon: 3075 bp. Deletion size: 2173 bp. Deletion left flank: GCCAGTTTTCTTTCAAATGTGTATCTCTTC. Deletion right flank: CAAAAACCCTAAAACTCTAAAACGATTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1884 Y55F3BL.2(ok2160) IV. C. elegans Y55F3BL.2. External left primer: TTTCACCCAATTTTCAAGCC. External right primer: GCTCACGGAATCTGTGTTCA. Internal left primer: CGAAGTGAGACGTTTAGGGC. Internal right primer: ATTCAATCGAATTTCGTGCC. Internal WT amplicon: 2938 bp. Deletion size: 1401 bp. Deletion left flank: ACGGGTCATAAAGCGAAAACGCGGAGGGTT. Deletion right flank: GATACATATGATGCTTAGATGTTGAAATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1885 spe-11(ok2213) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2213 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1051 bp. Deletion left flank: TGGGATGAATTTATGTGCAACATGCTCGTA. Deletion right flank: ACATTTTTATCATTATAACGAATATTCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1886 sbp-1(ok2363) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y47D3B.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2363 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATGCCACTTGTTCAGGGTT. External right primer: GCATGAGAGTTACACGCGAA. Internal left primer: TGGAGACATGTACCCGTTGA. Internal right primer: ATCACACGAGCCCTCAGAAC. Internal WT amplicon: 2759 bp. Deletion size: 1315 bp. Deletion left flank: TGCTTGATAAGACCCCCCTCTACTGCAACA. Deletion right flank: CAAAATCAGAACTCAAAAGCAAAGAAGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1887 dsh-2(ok2162)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans C27A2.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2162 homozygotes (sterile, lays eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACCAGACCCACTGCTGAG. External right primer: GAAGCTTTGCTCCGTACGAC. Internal left primer: TTCCGTGAGGAAATGGAGAC. Internal right primer: AATTGACCTGACCTTGGCTG. Internal WT amplicon: 2756 bp. Deletion size: 1104 bp. Deletion left flank: TTGTAAGCATGCGCCTTTTTAACATAAGTC. Deletion right flank: AGTCTTTCTCTGCGTCTCCTCTTCTTGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1888 mmaa-1(ok2514)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans T02G5.13. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2514 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATTGGTGCACTGGTCATT. External right primer: AATCACGATACCTTGGACGC. Internal left primer: TCGTTTCGAAATTCGTCCTC. Internal right primer: ATGCCTGGTGACGACTACCT. Internal WT amplicon: 2798 bp. Deletion size: 1179 bp. Deletion left flank: TTTAAGAACAAAAACGTACCAAATGTGCTA. Deletion right flank: ATAGAAATAAGAGATATCAAGTGTTGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1889 fars-3&F22B5.10(gk1029)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F22B5.10, F22B5.9. fars-3 is the new name for frs-2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1029 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTGTTGTTCCACCCACAAGA. External right primer: TGCCGTTTTCTGCTCTTTTT. Internal left primer: CAGCCAGATGCACTTTCTCA. Internal right primer: CATTTGGGAGTTTGGTGGAG. Internal WT amplicon: 1427 bp. Deletion size: 823 bp. Deletion left flank: TGCAGTTCATATTGGAAATCCAAAAACTCT. Deletion right flank: TATCACATGGCTTCTTGTGTATAGATCCGA. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC189 pmp-4(ok396) IV. C. elegans T02D1.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1890 tbx-7(gk1033) III. C. elegans ZK328.8. External left primer: GCTGCTCCACCTTTTGTTTC. External right primer: ATCACAGGGTGCATCTTTCC. Internal left primer: ACCCGAACTATCAGCTCGAA. Internal right primer: GCGTATGCACTCGAAGTGTG. Internal WT amplicon: 1994 bp. Deletion size: 488 bp. Deletion left flank: CTACTGATATCATTTCCATTATTATTGTGT. Deletion right flank: GCTCCATAAATTTCTATTTACCAGCTCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1891 F10A3.12(ok2192) V. C. elegans F10A3.12. External left primer: AAAAATGCTCCAAAGCATGG. External right primer: GATTTTTACGGAAAACGCCA. Internal left primer: CCCAAGCTTTTCAACTTTCG. Internal right primer: TGGGAACTTTTCCTGATTGC. Internal WT amplicon: 2833 bp. Deletion size: 1054 bp. Deletion left flank: GCATGTAAAAGCTATGGTTTGGTCCAACAG. Deletion right flank: GTTTTTCTGCTTCTACTACTTAAATGGACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1892 gkDf27 I; Y67A10A.7(gk3171) IV. C. elegans ZC581.1, ZC581.9, ZC581.12, C17F3.1, Y67A10A.7. Lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1894 +/szT1 [lon-2(e678)] I; peb-1(ok1941)/szT1 X. C. elegans T14F9.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1941 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GCGTGAGCAGTATGCCACTA. External right primer: GCCTGGGTTCAACATAGCAT. Internal left primer: AATTTAGGGCTTCCTTCCCA. Internal right primer: GCTGAATGGTGGCTCAACTT. Internal WT amplicon: 1610 bp. Deletion size: 779 bp. Deletion left flank: CTAGCTTTTGAGAGTGTCTAAGGGAATTGT. Deletion right flank: AAACGAATGATGAAGTTTGAAGTTGATGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1895 +/mT1 II; cyk-1(ok2300)/mT1 [dpy-10(e128)] III. C. elegans F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1896 ckb-3(ok2310) III. C. elegans B0285.10. External left primer: ACTATTCGTTGGCAACTCGC. External right primer: TGAACCGAAGACGAGACTCC. Internal left primer: GGACTCCGTAGCTGTTCTACAAA. Internal right primer: GGCCCGGACTCAGTAAAGTC. Internal WT amplicon: 3214 bp. Deletion size: 2055 bp. Deletion left flank: ATTAACATTTTGAGCTATTGGCAAAATAAA. Deletion right flank: CTTCCAAACTAAATTTGTCGAAACAAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1897 C32F10.8(tm2997) I. C. elegans C32F10.8. External left primer: GCATTCCGCATTCTCCCATG. External right primer: GCATGCGAACCGTACAAGCA. Internal left primer: CCCATGTATCCTTTGGATAC. Internal right primer: TTCCGGACTCGTCACAAGTC. Internal WT amplicon: 1307 bp. Deletion size: 594 bp. Deletion left flank: TAACTGCTTAGGAAAAAAAGCTCACTTATT. Deletion right flank: CATGGAATTCCTCCATCACGTCTCTTAATA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1898 Y66D12A.24&tin-10(ok2400) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y66D12A.22, Y66D12A.24. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2400 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCTCACTTGACACTTTCG. External right primer: TGGGGAAAATCGAAAACTTG. Internal left primer: CTGTGCAATTTGTGATTGCC. Internal right primer: ATATGTACCGCCGAATGACC. Internal WT amplicon: 2686 bp. Deletion size: 1690 bp. Deletion left flank: TTCATTTTGGCTAATTTCTCAGTAAAAATT. Deletion right flank: TTCGATTTAAAAAAAATCGATTTTTTTCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1900 T20H4.2(ok2547) III. C. elegans T20H4.2. External left primer: AGATGGGAGCCAAGACGTTA. External right primer: GACGTTGCCTTCGACATCTT. Internal left primer: TCATGCACATACAATGCCAA. Internal right primer: CTACCAAGTCACGCCCACTT. Internal WT amplicon: 2220 bp. Deletion size: 1394 bp. Deletion left flank: GGGGAATGATGGAAAGAACATTTACACTTT. Deletion right flank: ATGGGGTTAGTAATTCACCATTCGAATCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1902 lgc-4(ok2567) X. C. elegans F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGA TAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCC ATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAG TGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAAT CATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1904 hlh-34(gk1031) V. C. elegans T01D3.2. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 163 bp. Deletion left flank: TAAAAAACAGAAAAAAAATTAAAAATATAT. Deletion right flank: TTAAATCAAAAACTTAAAAGTTACCGAGTT. Insertion Sequence: TATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1905 F21G4.5(gk1035) X. C. elegans F21G4.5. External left primer: TTGATGGAACTTTCATGGCA. External right primer: ATGATCTGAGATGAACGGGG. Internal left primer: CCTCTAAATGCCGACGTTGT. Internal right primer: TCCTGATCAATTGCAGCATC. Internal WT amplicon: 1653 bp. Deletion size: 444 bp. Deletion left flank: TTGCAGGTACATTTTCCTTGGTGAACATAA. Deletion right flank: ACTTTTTTCCATGTCTCCCACAACGTAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1906 ceh-45(gk1015) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ZK993.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1015 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAATGGAGAGACGGGTGTGT. External right primer: TTGAAAATTGTGAAGCTGCG. Internal left primer: GGCGCCAGAGTTTGATCTAC. Internal right primer: AGGTTGATGTGGACGGAGAG. Internal WT amplicon: 1907 bp. Deletion size: 1113 bp. Deletion left flank: CAAAATCTTGGTAGTCTAGAAAACCCCAAT. Deletion right flank: CATGGTGTCCTAGGAATATTTTTAAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1907 Y97E10AR.7&rpb-9(gk1044) V/nT1 [qIs51] (IV;V). C. elegans Y97E10AR.5, Y97E10AR.7. Homozygous semi-sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1044 homozygotes (often sterile or nearly sterile, can be maintained). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTATGAAGCTTAGCGCGGAC. External right primer: GACCATTGACACCTCGACCT. Internal left primer: TGCCAGAAGCATTGTACGAG. Internal right primer: GGATGGGTTAACTGGGATGA. Internal WT amplicon: 1933 bp. Deletion size: 931 bp. Deletion left flank: TAGACTGATTATGAGCATGTTTTAAAAAAT. Deletion right flank: TTTTGTTCCAACATTTTTAGTTTAAAATTA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1908 mbk-2(ok2235) IV/nT1 [qIs51] (IV;V). C. elegans F49E11.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2235 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGAGCCGCTCAACACAGTT. External right primer: CGTCGGGCAATAGTAGAGGA. Internal left primer: CGTACAAACATATTGCCCCC. Internal right primer: ACTCACACAAACTGGGGAGG. Internal WT amplicon: 3315 bp. Deletion size: 2275 bp. Deletion left flank: TAGTAATTTTTTTAAGCCAAAAGCTCCTTC. Deletion right flank: TCAAGACCGGATACAGTAATTTTGACGCAA. Insertion Sequence: AGCTCCTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1909 flp-1(ok2505) IV/nT1 [qIs51] (IV;V). C. elegans F23B2.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2505 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGTCCCGTTTTGGATGT. External right primer: AGCGTCCGAATCTGAAGAAA. Internal left primer: CGGTACTTGCAAAGAAGGCT. Internal right primer: CTGCAGATCGTTTTCCGAAT. Internal WT amplicon: 1194 bp. Deletion size: 475 bp. Deletion left flank: GTATACTATTCATTTAAAAAATATTGCCTA. Deletion right flank: TTTCTGATAAAAAAGAGCACAACTTGGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1910 ncl-1(ok2555) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ZK112.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2555 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGCCAATATGGGACTCTC. External right primer: GGATGATACGGCTTTGTGCT. Internal left primer: AGCCATTCCTGTTCCAAATG. Internal right primer: GATTGGACTTCCTCCGTGAA. Internal WT amplicon: 3295 bp. Deletion size: 1644 bp. Deletion left flank: AACAAATGCTCAAAATGGAGCAATTGATTG. Deletion right flank: TTCTCTCGTAGATTGATGTCCTTCGCGTCG. Insertion Sequence: AATTCTCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1911 C01B12.2(gk1032) II. C. elegans C01B12.2. External left primer: AGACGCCATGATTTTCAACC. External right primer: AACCGTAATGGGACAGCTTG. Internal left primer: GAACCTGCGGTTCAAACAAT. Internal right primer: AGGGAGTGAGCGAGAAACAA. Internal WT amplicon: 2259 bp. Deletion size: 561 bp. Deletion left flank: AAACGTGGTTTTGCCCGAGTTCTCTGAAAC. Deletion right flank: AAGCAATTTACTCAAATTATTTCAGTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1914 C47G2.3(ok2557)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans C47G2.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2557 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAATCCGTCTGACTCCTCGT. External right primer: GCTGAAAATGAGGTTTGGGA. Internal left primer: GTTGCAAACCTGGGTGGTAG. Internal right primer: GTACTCCTCCCGGACAATGA. Internal WT amplicon: 2124 bp. Deletion size: 1307 bp. Deletion left flank: TTAGGGTTAGCTGGAAAATTTTTTGATTAA. Deletion right flank: CCGTTTTTGGGATCAATTGGTCTGCTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1915 klp-18(ok2519) IV/nT1 [qIs51] (IV;V). C. elegans C06G3.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2519 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTAAACTAGCGATGCCCG. External right primer: GAATTCCGTCCGAACCTTTT. Internal left primer: TCTTCAATCATTCACCGCTTT. Internal right primer: CGTCAACCTCTTGGCGTAGT. Internal WT amplicon: 1183 bp. Deletion size: 556 bp. Deletion left flank: TATGAGCTCCATCATATCTTTGATAGCTCT. Deletion right flank: GTCAAGGAAAGGTCATCTATCCTGAACCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC192 tag-18(gk108) X. C. elegans T14G12.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1923 unc-22(gk3071) IV. C. elegans unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3071), it is homozygous for 323 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
VC1924 unc-22(gk965) IV. C. elegans Unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk965), it is homozygous for 546 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
VC1925 fkh-9(ok1709) X. C. elegans K03C7.2. External left primer: CGAGCTGGGCTAGTGGATAG. External right primer: GCGTTTAACTTTGAGGCAGG. Internal left primer: GCATGTGCAAACTAGGAGCA. Internal right primer: ACGGGGTTTGAGTTGAGTTG. Internal WT amplicon: 3077 bp. Deletion size: 1054 bp. Deletion left flank: AGTTCATTTTGCTGGTTGTTTGTTGCATTG. Deletion right flank: TCATACTGTAGTTGGCAAATATTGAAAGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1927 fib-1(ok2527) V/nT1 [qIs51] (IV;V). C. elegans T01C3.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2527 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTTCCGACGAGGAGAAGTG. External right primer: GCTTCCTCGTTATTTGCAGC. Internal left primer: AAGGTCTGAACCGATTGCAC. Internal right primer: TGCTACATATGCCGATTCCA. Internal WT amplicon: 2241 bp. Deletion size: 1271 bp. Deletion left flank: GGCAAGGTTGAGAACCAAGTAAAGATAAAA. Deletion right flank: AAAAATCCTGAAATTCAGTTTACCTCCGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1928 Y62E10A.17(gk902) IV/nT1 [qIs51] (IV;V). C. elegans Y62E10A.17. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk902 homozygotes (mostly sterile; eggs sometimes hatch but larvae are abnormal and arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGATTCAGTTGGCGTCTCTG. External right primer: TCTCGTCGTCTCATCCCTCT. Internal left primer: AACCCGTTGAGACACGATTC. Internal right primer: CCATTCCATTACTTGGCACA. Internal WT amplicon: 2267 bp. Deletion size: 1096 bp. Deletion left flank: TGCTGACATACATTCTCTGAAATATTTGGA. Deletion right flank: TTTTTCTGTGCCGCACTTTGGTTTTTTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC193 him-6(ok412) IV. C. elegans T04A11.6. Him. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1930 mrps-30(ok2469) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans B0511.8. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2469 homozygotes (late larval arrest or sterile adult, Unc, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAAATGCCTATCGAGACC. External right primer: CCCGAATCTCCTAATGCTCA. Internal left primer: AGCATTTTTCTGCGTCCCTA. Internal right primer: ACACGCCCTGCTACTGATCT. Internal WT amplicon: 2582 bp. Deletion size: 1317 bp. Deletion left flank: GAACACTCAAATATTGTCCATTTTTATCAC. Deletion right flank: GTGTGTCTTCATCAGAAAAGTTGATTCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1931 K03D10.3(ok2429)/hIn1 [unc-101(sy241)] I. C. elegans K03D10.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2429 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTGTTTGAACTCACCCCG. External right primer: AAATTTCCGGTTTTCTGGCT. Internal left primer: TAAAAATTGGGTGAGGCTCG. Internal right primer: TACGGGAAAAACTGCCAAAA. Internal WT amplicon: 3157 bp. Deletion size: 2168 bp. Deletion left flank: AACTGTAATTTACGGTGTTTTATATCGAAT. Deletion right flank: GCATTTAAATCGATTTTTCCCATAAAATCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1932 T07A5.5&unc-69(ok2448) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T07A5.6, T07A5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2448 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGTAACCACTTCTCGCC. External right primer: CTTCATCGATCGGCTTTTGT. Internal left primer: CGGCTGTGAACTCATGACATA. Internal right primer: ATTCAAAGCTCGAGCCAAAA. Internal WT amplicon: 2903 bp. Deletion size: 1464 bp. Deletion left flank: GAGCATGAGCATCGCGATTCCAAGAATGTT. Deletion right flank: ATATTTAGTGTAGTAAAACTGTTACGAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1934 C47A4.2(ok2161) IV. C. elegans C47A4.2. External left primer: GGGCCAAACTTTCAACAAAA. External right primer: CGAATTACGCAGGGAACAAT. Internal left primer: TAGCTCCGATGAGCACAATG. Internal right primer: GGACCAGGCTGCAAAAATAA. Internal WT amplicon: 3359 bp. Deletion size: 1566 bp. Deletion left flank: AGAACATACCTTTTGAGTATCCGAGAAATT. Deletion right flank: TTTCTCTGTGCACAAATTTGTTTTAAGTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1936 madf-9(gk3057) IV. C. elegans madf-9. Homozygous viable deletion, detectable by nested PCR. External left primer: AACAAAACGCATAACCTCCG. External right primer: TCGGCCAAACTTCATTTTTC. Internal left primer: AAAGAGAGAAGAGGGAGCCG. Internal right primer: GGCCAAATCTTTGTGGTTTG. Internal WT amplicon: 1269 bp. Deletion size: 784 bp. Deletion left flank: CCTCCCAACCGCACACATACTACCAACGAT. Deletion right flank: TTAAATTGAGAAATGAAAAAAAAGGTCACG. Validation: gk3057 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1937 elpc-3(ok2452) V. C. elegans ZK863.3. External left primer: TCCTTACCAACGGTCGAAAC. External right primer: CACTGGTCATCTTGAAAGCG. Internal left primer: TTGAAATTTCCGGCTAATCG. Internal right primer: ACTTGAATCGGCTGAAATGC. Internal WT amplicon: 2431 bp. Deletion size: 1504 bp. Deletion left flank: CGGTAGTACTCTCGAGTTCCAACGCCCGAG. Deletion right flank: GACGGAACTCCAGCGATAATGTCAACGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1939 aka-1(ok2520) II. C. elegans D1022.7. External left primer: GCCTTTTGGAAGATGGTCAA. External right primer: CCGATGAAGGAAATCCAGAA. Internal left primer: TTAATGGGATGCGGAAAGAG. Internal right primer: GCAGAATTACGGATGGAGGA. Internal WT amplicon: 3291 bp. Deletion size: 1311 bp. Deletion left flank: ACAAAAATATCAATGTTACTTACCATTGAA. Deletion right flank: AAAAATTTGTACAGTGCAATTCAAATTTTT. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC194 cua-1(gk107) III. C. elegans Y76A2A.2. Slow-growing, otherwise superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1942 F38H4.10(ok2146) IV/nT1 [qIs51] (IV;V). C. elegans F38H4.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2146 homozygotes (grotty, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTCACCACTTCCCGTCTTC. External right primer: CGCATTTTCAGAATTTGGTG. Internal left primer: CAAAATGCGAATGGACAACA. Internal right primer: GGGAATCACAGAATTGGGAA. Internal WT amplicon: 2120 bp. Deletion size: 934 bp. Deletion left flank: ATTCTTTGAATGACTACTGTAGCGCCTGTG. Deletion right flank: GAAGAAACTGAACCATTACGGGAAATCATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1944 unc-29(ok2450) I. C. elegans T08G11.5. External left primer: GCGTTACAGAAGTCTGCCCT. External right primer: TGACGTCTCCAGTCCCTCTT. Internal left primer: TGTTATTTGATTCACCCGCA. Internal right primer: TTGACGGGCGGTTAATATGT. Internal WT amplicon: 3194 bp. Deletion size: 1480 bp. Deletion left flank: CGATGAGTTCTTGGTCCTCGGAAATATACA. Deletion right flank: AACATTTGTATGCATAACTTGATCTTTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1945 H08M01.1(ok2518) IV. C. elegans H08M01.1. External left primer: GCCTAGGATTCAGGTGGGAT. External right primer: TCATTGTGTGAACGAACGGT. Internal left primer: TGTTTCATGGGTTGGGAAAT. Internal right primer: TGATTGGGCATTCGAAAAAT. Internal WT amplicon: 3201 bp. Deletion size: 1630 bp. Deletion left flank: AAACTTTTTCGCAGCAATGACTTTTGGGGC. Deletion right flank: TCTGTGTTGGTGGATTTGGTCGCGCATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1946 pbs-6&cids-1(ok2511) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2511 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1604 bp. Deletion left flank: AATACTGGCTTACAAAATTTGAATCTTCTC. Deletion right flank: GAAGATCGAATCAAGGCAGATTTGTTAGAG. Insertion Sequence: GAATCAAGGCAGATTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1947 nuo-4(ok2533) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2533 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1369 bp. Deletion left flank: TATGTCTTTCAGTATATCAAAATTAAAAAT. Deletion right flank: ATGAACAACTCCTCTGACTTGATTTGAGAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1948 R151.8(gk1047) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans R151.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1047 homozygotes (sterile, does not lay eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTGGTCTTCTTCTTCTG. External right primer: AGTTCTTCTCGACGACGCAT. Internal left primer: GAGATGCATGTCGTGTCGAT. Internal right primer: ATTGTTTCAGCACGGGAAAG. Internal WT amplicon: 2188 bp. Deletion size: 1135 bp. Deletion left flank: GGTTCTTCTCGGAATTATTGTAGTTTTTGG. Deletion right flank: GTAGAATCTCCTGCCAATGACCATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC195 tag-18(gk109) X. C. elegans T14G12.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1950 K02B7.3(ok2382) II. C. elegans K02B7.3. External left primer: GCTAATCAGCGGAAAAGCAC. External right primer: TTAATGCCAACAAACCGTGA. Internal left primer: GATTTTCTATCGCTCTGCCG. Internal right primer: GAAATTTCCAGAAATGCCCA. Internal WT amplicon: 2157 bp. Deletion size: 1347 bp. Deletion left flank: GCGACTGTTTTCCAAAGTGCTCCTCTGTCG. Deletion right flank: TTTTGTGGAGAGTCTGAAAATTTTAAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1951 gcy-29(ok2475)/mT1 II; +/mT1 [dpy-10(e128)] III. C. elegans C04H5.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2475 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCCTACGTGGCAAGTACA. External right primer: AAAATGACTCACGAAACGGG. Internal left primer: TGCACGTGGCAAGGTATCTA. Internal right primer: TGCAAAAATGTTGGAGAGCA. Internal WT amplicon: 3309 bp. Deletion size: 1504 bp. Deletion left flank: TTGCAAATTCGGCAGAAGTTGCAGTGTATG. Deletion right flank: TTCAAAATGAACTTCCATACACTTACCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1952 pmt-2(ok2419) V/nT1 [qIs51] (IV;V). C. elegans F54D11.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2419 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCCGAAATGAGACACCAC. External right primer: CCCACCCTCGATTTACAGTC. Internal left primer: GTTTTCGGTCGGTAGAGCAC. Internal right primer: TTTGAAATCGATCGAAAAATTG. Internal WT amplicon: 3161 bp. Deletion size: 2665 bp. Deletion left flank: TAGTTTTTCAATAAATAAATACACTTTTTT. Deletion right flank: GTTGGCAATCGCTTTGGAACGACTTCACGA. Insertion Sequence: AATCCTGAGCAAAAAAGTTAAGTAGTTGAAAAAAAGTTAAGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1953 pms-2(ok2529) V. C. elegans H12C20.2. External left primer: ATTCGGCTCGATCAGGTAAA. External right primer: TGAAAGAAAACGTGTGCGAG. Internal left primer: GGTTGATCTAGCTTCGCCAG. Internal right primer: GAACATGTCGAATGAGGCAA. Internal WT amplicon: 2942 bp. Deletion size: 2158 bp. Deletion left flank: CATCTGATTAGGATATTGTGATACCACTGC. Deletion right flank: TAGCAGCAGATTGACGGCAAATGATATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1954 clec-68&clec-69(ok2549) IV. C. elegans F56D6.15, F56D6.1. External left primer: GTCTCGATTTGGTAGCAGGC. External right primer: AGACTGTGTGCCACCTGATG. Internal left primer: TGCACTCCAAGGATAGTCCC. Internal right primer: GGGCTGCTGTAGAAGGTCTG. Internal WT amplicon: 3106 bp. Deletion size: 2663 bp. Deletion left flank: TTTCAAACATCGTCTCAAAAGTCCGCAAGT. Deletion right flank: TTTTCTCAACTGATTTTGCATGGTTAAGTG. Insertion Sequence: TTCTCAACTGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1955 lin-12(ok2215) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans R107.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2215 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCTTTTCTCGCAGCTCCA. External right primer: CATACATTTGCGTGTGTCCC. Internal left primer: GGGCTGTCATTCCGTTTCTA. Internal right primer: AAACCTGGGAACACATCGAC. Internal WT amplicon: 3327 bp. Deletion size: 1227 bp. Deletion left flank: ATTAATTCTGTTGGTGTGGTTTGGTTTTAT. Deletion right flank: GATTTCTAGAAAACAAACTGGTTGCTTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1956 tam-1(ok2635) V. C. elegans F26G5.9. External left primer: TATCTCTTCCCAATCGGCAC. External right primer: CGAGTTCATGCTCAGCACAT. Internal left primer: TGTTTGCGAGAGAACCTTGA. Internal right primer: GTCTACTCGGAAGCTGGTGG. Internal WT amplicon: 1314 bp. Deletion size: 339 bp. Deletion left flank: GTTCATGTTCGGTTGCTGCATTCGTTGATG. Deletion right flank: ATGATTGAGCGCGCCTCGTAAATTTCTGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1957 sfxn-1.2(gk3039) II; flp-14(gk1055) III. C. elegans Y37D8A.15, F37H8.4. The allele gk1055 was identified by PCR screening, has been validated by CGH analysis, and can be detected with the following PCR primers. External left primer: CGGCAAGCCTAGTAGGTAGAC. External right primer: CGGAGAGCAATGTTGAGTCCTC. Internal left primer: CCTTTGCCAGTTTTTTCCCTTTGG. Internal right primer: TTCTTACAGGCAATGGCTGGAC. Internal WT amplicon: 2702 bp. Deletion size: 652 bp. Deletion left flank: GAAAAACGAAAATTGGCAGTAGGCAGGCAG. Deletion right flank: ACAGAGAGTAGGTAGACAATAAGCAGGCAA. The allele gk3039 was identified by CGH and not confirmed by PCR. Left flanking probe: TGTTAAATATTGGCCAGAGTTGACTCAATCTTTAGTTAATTTGGCGTAGT. Right flanking probe: CATCTGCCGAATTTTCCTTTATAACATTCCAGAACAAGAACAGTATTGCT. Left deleted probe: ACAGTTTCAGATGCCCGCCAACATGCTCATCAACGGAATGCTCTTGAGCC. Right deleted probe: GAGCTATGGCTGCTGCTCTGTCACTGAATGCGATGGTTAAGGTAAACAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1959 B0285.6(ok2312) III. C. elegans B0285.6. External left primer: TGAGCTCCAGAATTCCAGGT. External right primer: CCTTATCCATTTTCGGCTCA. Internal left primer: TGAGCTCGCAGATGAGAGAA. Internal right primer: TCTTTGAGCCACGTCACAAC. Internal WT amplicon: 3197 bp. Deletion size: 1459 bp. Deletion left flank: GCTGTGCATTGATGGCTCCGATTGCCTATG. Deletion right flank: GACCATCATTCTCATTTATGCTTCCGATGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1961 F26H9.8(ok2510) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F26H9.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2510 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAACATCCCATCCCGAATA. External right primer: CCATTTCACGAATTTCGGTC. Internal left primer: GTGACCCTTCGAAAAGTGGA. Internal right primer: TTTCAGTTTTTGGCACGTTTT. Internal WT amplicon: 1143 bp. Deletion size: 783 bp. Deletion left flank: CAAGTGGAGGTCATCCTCGATTTTGGCCGA. Deletion right flank: CAAAATTCTAAAAAATCGGCACTTGGAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1962 pbs-6&cids-1(ok2516) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2516 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1268 bp. Deletion left flank: GTGGTGAGGATGATGTTATCATTCCTGAAT. Deletion right flank: CGTTGAAGAAGCGAAAAAGAATGCACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1964 F38B7.1(ok2506) V/nT1 [qIs51] (IV;V). C. elegans F38B7.1. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2506 homozygotes (Unc, mostly sterile with vulval blip, but some animals reproduce). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCATCTCACCGGAAGGAAC. External right primer: AACTTGGATGAAACGTTGGC. Internal left primer: AGCACCACCACCAAAGAATC. Internal right primer: AGCTATTGCGATTGCGGTAA. Internal WT amplicon: 2935 bp. Deletion size: 973 bp. Deletion left flank: GTCACAGTATCATAATGTCACAATGAAGCA. Deletion right flank: TTTCCCAATCAAATCTCTTCATTATTTTAT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1966 apm-1(ok2578) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F55A12.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2578 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAGGGATGACTGTTTTGGC. External right primer: ATTACGGCTTCCACGTTTTG. Internal left primer: TGGCTTGAAGGATATTGGGA. Internal right primer: ACATGTCGATTTCCGGTCTC. Internal WT amplicon: 2261 bp. Deletion size: 1825 bp. Deletion left flank: TAAAGATAATATAGAAAAAAAAAATTTCGG. Deletion right flank: AAACTCACATTTCCTTTGAGGTCCAAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1970 gkDf42 gkDf43 I; Y47D3B(gk1197) III. C. elegans This strain is homozygous for a deletion (gk1197) in Y47D3B, detectable by PCR using the following primers. External left primer: AAACGCGAAAATGTCGAAAC. External right primer: GATGTCTTCTCCCCCTCCTC. Internal left primer: GCGTCAAATATGTCGCGTAA. Internal right primer: TTAGTAGGCGGCTTTGTGGT. Internal WT amplicon: 1949 bp. Deletion size: 233 bp. Deletion left flank: ACCCCTGGACGTTTGGGCGCGTTTTTGTCA. Deletion right flank: TTTTCAGATAGTACACACACACATAGGAAA. Validation: No CGH probes for gk1197. Other deletions (gkDf42, gkDf43) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1971 flp-24(gk3109) III. C. elegans This strain is homozygous for a deletion (gk3109) in C24A1.1, detectable by PCR using the following primers. External left primer: AGACCACGCCTACTACTTGGC. External right primer: CCATGTTGCTTCCAGTGCCAC. Internal left primer: CGATGTTCCGCTCTGAGCTTC. Internal right primer: TGGTCACAGTGCATTGCTCTC. Internal WT amplicon: 2029 bp. Deletion size: 1180 bp. Deletion left flank: TTTCGAAAGCTTGCCGCAAAACTCTGCCAT. Deletion right flank: AGACCTAAAAATTCCGGCAAATACCACATT. Validation: gk3109 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1973 T01C3.3(ok2482) V. C. elegans T01C3.3. External left primer: CCTGGCTGTTACCCAAGTGT. External right primer: GCTCACATGAAGTGCAGCAT. Internal left primer: CGAGAAGGGAAATTCCACAA. Internal right primer: TGTGTAGGCTCCCTAATGCC. Internal WT amplicon: 2419 bp. Deletion size: 1629 bp. Deletion left flank: TTGAACGCAACATGATTCTCATCGGTGTAA. Deletion right flank: GTAAATATACAGAGAGATTTTACGCGTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1974 F02E8.2(ok2295) X. C. elegans F02E8.2. External left primer: GACGGTGCTCATTCTTCCAT. External right primer: GAGTGGTGGATTGGGAAAGA. Internal left primer: CCAGTCCATTGCTCAATTCC. Internal right primer: CAAGCGGGTCGTTTATTTGT. Internal WT amplicon: 2195 bp. Deletion size: 1115 bp. Deletion left flank: ACTTTTATTGTGAGTTGTGCATTGCAGTTT. Deletion right flank: ACATTTTCTTTGTATTACAGTAAATTTAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1975 H14N18.4(ok2566) V. C. elegans H14N18.4. External left primer: TTCCGAGTCTGGCTGAAACT. External right primer: GGCGGATTTGTCATGACTCT. Internal left primer: AAATTGTCGCGTTGCTTACC. Internal right primer: TGCGTAAGATATTTTCTCATAACTG. Internal WT amplicon: 1211 bp. Deletion size: 844 bp. Deletion left flank: TTAGAAAATTATTTTGAAAAGTGTTAAATT. Deletion right flank: GTTTCACGAGCATTTATAGTTTGACACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1976 tbx-7(gk1034) III. C. elegans ZK328.8. External left primer: GCTGCTCCACCTTTTGTTTC. External right primer: ATCACAGGGTGCATCTTTCC. Internal left primer: ACCCGAACTATCAGCTCGAA. Internal right primer: GCGTATGCACTCGAAGTGTG. Internal WT amplicon: 1994 bp. Deletion size: 932 bp. Deletion left flank: ATCTACTGATATCATTTCCATTATTATTGT. Deletion right flank: TATTAGTAGATGAAAAGGAGGAAAAGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1977 F35D2.4(ok2142) II. C. elegans F35D2.4. External left primer: CAAGAAAGCCAACAACTCCC. External right primer: TCGTTCACGAAACATTGCAT. Internal left primer: TTCAAATGAAGTCCAAGCCC. Internal right primer: GCCCTTCACAAAGCACTCTC. Internal WT amplicon: 2754 bp. Deletion size: 1217 bp. Deletion left flank: TGAGAGATAGACAAAAATTGTAACCGCTAA. Deletion right flank: AAATGGAGCAAATGGGTTCAGAGAGTCATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1978 T24B1.1(ok2604) I. C. elegans T24B1.1. External left primer: ACCGAACTTGACGAATCCAC. External right primer: TGAACAGGACGATCACTGGA. Internal left primer: TAAAGTGTCCGATATTGCCG. Internal right primer: TCCGATTCCTTGCTGAATTG. Internal WT amplicon: 1116 bp. Deletion size: 494 bp. Deletion left flank: GTTATCACTGAAGATTTCGGCAGACCGGCT. Deletion right flank: GAAAACCAAAAAGTATCAAGTCATGAAATG. Insertion Sequence: AAAGACCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1979 R12B2.3(gk3268) R12B2.2(gk3269) tbx-34(gk1051) III. C. elegans This strain is homozygous for a deletion (gk1051) in Y47D3A.10, detectable by PCR using the following primers. External left primer: AGTTGTGGCTTCTGCGAACT. External right primer: CACCCACTGACACCATTGAG. Internal left primer: ATGGTCAGGACGGGAATGTA. Internal right primer: TTTCTCCACTGCAACGTGAC. Internal WT amplicon: 2318 bp. Deletion size: 971 bp. Deletion left flank: TTTTTGTGCAGCAATTTTTGCGGCGGCTGA. Deletion right flank: GGTGTCAGTGAATGTAGGCAGCCATGAAGC. Validation: gk1051 passed by diagnostic PCR, CGH. Other deletions (gk3268, gk3269) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1980 F28H6(gk1053) X. C. elegans This strain is homozygous for a deletion (gk1053) in F28H6, detectable by PCR using the following primers. External left primer: TAAATGATTGCGCCATTTCA. External right primer: TAAAAATCACCTTCCGCCAG. Internal left primer: TTCCACATCACGCAGCTTAC. Internal right primer: TTCCCTCGAATTCACATTCC. Internal WT amplicon: 2143 bp. Deletion size: 831 bp. Deletion left flank: GAGATGAATGTTATATCATTATGAGATATC. Deletion right flank: ATTTAGTTTTCAGATGGCTCCATCAAAAAG. Validation: gk1053 passed by diagnostic PCR, CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1981 flh-3(gk1049) IV. C. elegans Y11D7A.13. External left primer: GTCGCTCCCAATTTTAACCA. External right primer: AGTGTGGACTACCTGTGGGG. Internal left primer: GCTTCGGAGACGACTGAATC. Internal right primer: AGAGGAGGAAGATTGGCGAT. Internal WT amplicon: 2128 bp. Deletion size: 1200 bp. Deletion left flank: GGAGACGACTGAATCTTCGTATTGAATCTT. Deletion right flank: TAACTTTTCAGCCTCAACAAACCAAGAACC. Validation: gk1049 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1982 flp-25(gk1016) III. C. elegans K04H4.7. External left primer: CCTAGTGTACTTCCGTATCCG. External right primer: GTGCAGCGACTTGATAGTGAG. Internal left primer: ATAGTCAGTGAGAGACGCTGG. Internal right primer: CCGCCTTCGATCGATTTTCTG. Internal WT amplicon: 2295 bp. Deletion size: 673 bp. Deletion left flank: CGCCTATAATATAAATCCAATAAAATTTGA. Deletion right flank: GTTGAACAAGTTTTAATAAAACCAATGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1984 cky-1(gk1052) V. C. elegans C15C8.2. External left primer: TCAACATCACCCAACTGGAA. External right primer: ACATGATGACCCTTTAGCGG. Internal left primer: CATCCTGCAGCTCAAGTGAA. Internal right primer: GCTTACACGCATGCCATAAA. Internal WT amplicon: 1542 bp. Deletion size: 195 bp. Deletion left flank: ACTATTTAAAAAAGCTGACAGTAATTTTCA. Deletion right flank: CAGTATGATTTTTCATAACAAATTAAGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1985 F47G4.6(gk1056) I; daf-3(gk3330) X. C. elegans This strain is homozygous for a deletion (gk1056) in F47G4.6, detectable by PCR using the following primers. External left primer: CGCTTCTCCTGAGGTAGTGG. External right primer: GGACACTTCGAACCGGATTA. Internal left primer: ACGATGGATCGGTGTTTCTC. Internal right primer: AGCTGCCTAGCCTTCTCCTC. Internal WT amplicon: 1914 bp. Deletion size: 457 bp. Deletion left flank: TTAGCCTAAAAAATTTTTCCGAATTTTCTC. Deletion right flank: AGCTACCGTACTCATAAGCTACAGAGTGTA. Validation: gk1056 passed by diagnostic PCR and CGH. Other deletion (gk3330) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1986 Y54G2A.20(gk1060) IV. C. elegans This strain is homozygous for a deletion (gk1060) in Y54G2A.20, detectable by PCR using the following primers. External left primer: TCGCAATGAGTGTTCTCCTG. External right primer: CTCATTCCCTGAACTCTCGC. Internal left primer: GGACAGGCCGCATACATATT. Internal right primer: ATCTCAAGAACGTTCACCGC. Internal WT amplicon: 2280 bp. Deletion size: 751 bp. Deletion left flank: GCCCTTAGATGCCAGAGCGGAAATTTCCAT. Deletion right flank: ATGGTTGAGAACTGACGCTTTGGATGAATA. Validation: PCR diagnostic for gk1060 equivocal. No CGH probes for gk1060. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1987 F52C9.3(ok2530) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F52C9.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2530 homozygotes (sterile with few eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAGCAGTTGATACACAA. External right primer: TAGTTCCCTAAAACGTGGCG. Internal left primer: TTGGAACTGTTGTCACTGGC. Internal right primer: GGATGTTGGCAGGAAAATGT. Internal WT amplicon: 3134 bp. Deletion size: approximately 1000 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC199 sir-2.1(ok434) IV. C. elegans R11A8.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1990 +/mT1 II; mup-4(ok2321)/mT1 [dpy-10(e128)] III. C. elegans K07D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2321 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATGGCAGGAATTGTTT. External right primer: GCGGTAACGGACTTTGTCAT. Internal left primer: GAAATGAGCACGGGGATTTA. Internal right primer: GCTTCTTCATGTGACTGGCA. Internal WT amplicon: 2913 bp. Deletion size: 1384 bp. Deletion left flank: TATTTTATTTGGTTTTACCTGACTCTGACT. Deletion right flank: AACAGTTTACTTAATAATCAGCTTTATTGA. Insertion Sequence: ACAGTTTACTTAATAATCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1992 egas-2&Y69H2.3(ok2651) V. C. elegans Y69H2.12, Y69H2.3. External left primer: ACCTGCGATAGTGGATGGAC. External right primer: AAACGAGGAGTACCGGTGTG. Internal left primer: TGCGTCCCGTATAAGGATTC. Internal right primer: GGAACCCAAGAGTACACGGA. Internal WT amplicon: 3178 bp. Deletion size: 1934 bp. Deletion left flank: TGTTAGGTACAATGCACAGCCAAATGCCCA. Deletion right flank: ATCTGAGCCTATTTGAGTCGGCCTAAAGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1993 nhr-288(gk1028) V. C. elegans Y51A2B.3. External left primer: TTCCGCTGAAATGTTTTTCC. External right primer: TCATTGAATTGTTCCTGCCA. Internal left primer: TTCTCCATATTGCCCAGACC. Internal right primer: AAATACATCCACTGGGAGCG. Internal WT amplicon: 2180 bp. Deletion size: 699 bp. Deletion left flank: TTATTCGAATTTTCAATTTTCATATAATTA. Deletion right flank: GAAACCCATTTTCATAGAAATTCTCCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1994 ncbp-2(ok2496) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F26A3.2. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2496 homozygotes (probably viable Dpy, sometimes blistered, often sterile). Use care when maintaining - viable WT non-GFP animals are most likely rare recombinants. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAATTTTCACCTGCCTCA. External right primer: AAGGAATAAGGGGGTCATCG. Internal left primer: GCATGCAGCACTAATTTCCA. Internal right primer: TGTAGTCCAACATTGGCGAG. Internal WT amplicon: 2328 bp. Deletion size: 1024 bp. Deletion left flank: AAAAGTTGTTAAAACAAAAGGCTTACCTGG. Deletion right flank: GACAAAAGGATAAAGTCGACATTTTTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1995 T12A2.15(ok2509) III. C. elegans T12A2.15. External left primer: ACTGGTTATCGAAATGCGGA. External right primer: ACAACAAATGTCGGACGTGA. Internal left primer: TCCTTATTTCCATCCAACGC. Internal right primer: ATGGTTGGTGGAGTCTCTGG. Internal WT amplicon: 3157 bp. Deletion size: 1090 bp. Deletion left flank: TTCTTGGGTTCGGGGTTTCTGATCGTTTTG. Deletion right flank: GATTTCCGCGTACGGATCTGATTTTCCCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1996 T08B2.4(ok2534) I. C. elegans T08B2.4. External left primer: ATTTCAACAAGAACCGCTGG. External right primer: ACACGAGTTCATATTCCGGC. Internal left primer: ACGCGCATCAGTTACAAGAA. Internal right primer: AGCCTATATCTCCGTGCGAA. Internal WT amplicon: 1244 bp. Deletion size: 478 bp. Deletion left flank: GCCCTGGCAAGGCGATGTGGAGTTGAAGAT. Deletion right flank: TGTTTTTCTTCTACTTTTGAAATTGCTCCA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1997 F40F11.2(ok2621) IV/nT1 [qIs51] (IV;V). C. elegans F40F11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2621 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATCTGCACAGCCTTCTCAA. External right primer: GAGCAGGTCTACCCTTCACG. Internal left primer: AGATAATGCCACCACAGGCT. Internal right primer: TGTTGAAGCAGGTGGAATTG. Internal WT amplicon: 3165 bp. Deletion size: 2394 bp. Deletion left flank: AGGAATCAATGCAATATGGTCACCAACAGA. Deletion right flank: AAGTTGCATGTTAAGATAAAAGCTTCACCA. Insertion Sequence: CATATAATAAGTACAATACATACAATATAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1998 C25H3.11(ok2632)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans C25H3.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP o2632 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTGTTGAGCTTTGTTCCCA. External right primer: AAATCGATGAAAATTCCGCA. Internal left primer: AATCAACGCTCACTCGCTCT. Internal right primer: GGAATTCGAAAACCACGATG. Internal WT amplicon: 3051 bp. Deletion size: 1740 bp. Deletion left flank: CTCTCCTGGTTCCCATATTGTAGTTGGACG. Deletion right flank: ACTGTGTCATCTGATGCCTCGTCAATTCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1999 eif-3.E(ok2607) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans B0511.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2607 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATCTCCGTGTTTGCCACA. External right primer: GATGAGAAATCCCTGACCGA. Internal left primer: TCGCCTTGACTTTGTCTTGA. Internal right primer: GACTCCGTTGTTGCCATTTT. Internal WT amplicon: 1140 bp. Deletion size: 578 bp. Deletion left flank: GTTCAGCTTCCTCTTGGCTCATATTCAATC. Deletion right flank: CCATTCTTGGAGCAGAATTTCACTGGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC20 nhl-1(gk15) III. C. elegans F54G8.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC200 rnt-1(ok351) I. C. elegans B0414.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2000 mca-1(ok2532) IV/nT1 [qIs51] (IV;V). C. elegans W09C2.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2532 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGGTTAGAAGCTGACGAGCG. External right primer: TGAATCCGATCCAGTTCTCC. Internal left primer: CAGTCGGCAGATTTCACAGA. Internal right primer: CCGGAAAAATGCTCATCACT. Internal WT amplicon: 3166 bp. Deletion size: 1418 bp. Deletion left flank: TCGCGGATTCTCTCATTGAATTCCTTTCCT. Deletion right flank: ACTTTTCCATTTTCGTCGCGGATTCTCTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC20007 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20008 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20009 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20010 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20011 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20012 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20013 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20014 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20015 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20017 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20018 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20019 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20020 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20021 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20022 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20023 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20024 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20025 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20026 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20027 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20028 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20029 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC2003 +/szT1[lon-2(e678)] I; mIs12 II; sec-3(ok2238)/szT1 X. C. elegans F52E4.7. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation, and homozygous for unlinked pharyngeal GFP insertion mIs12 (artifact of strain construction). Balanced lethal heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2238 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain.External left primer: CAATCTTCGAGCCTGGGTAA. External right primer: TACCTTCCAGTCCAGATGCC. Internal left primer: TGAAATGGCGATTTTGATGA. Internal right primer: CATGATATGGCGATGCAAAG. Internal WT amplicon: 2918 bp. Deletion size: 1120 bp. Deletion left flank: TTTCTCCATACTACGTCCTCCGAGACTTGA. Deletion right flank: AATGAAACGATTTCCTCGTTGAGACGTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC20030 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20033 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20036 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20037 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20038 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC2004 +/szT1 [lon-2(e678)] I; C03F11.3(ok2598)/szT1 X. C. elegans C03F11.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2598 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGACAAGGCAATGAGACC. External right primer: TGGGAGCTTTAATCGAAGGA. Internal left primer: GCCAAGTCCAACAGCTATCC. Internal right primer: CAATTGCTCTTTTCGGGCTA. Internal WT amplicon: 1231 bp. Deletion size: 302 bp. Deletion left flank: GTAAATCCCCATTGCAAACAAAAAAAGTGT. Deletion right flank: CAGTACGTTTTATTAGCGTAGGGCCACCTA. Insertion Sequence: ACCAACGCCGAGTTCGGGTCCTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC20040 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20042 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20043 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20044 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20045 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20046 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20047 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20048 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20049 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC2005 ZK973.9&lpd-5(ok2652) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ZK973.10, ZK973.9. Homozygous lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2652 homozygotes (late larval arrest or sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTTGAGGCTGTTGTTGGTT. External right primer: GAATCGGCGCTACTCATCTC. Internal left primer: GCAGCGGTACCATCATCTTT. Internal right primer: TTACAACGGGAGACAAAGGG. Internal WT amplicon: 2218 bp. Deletion size: 1384 bp. Deletion left flank: ACTCCTTTTTTGCAAAAAAAAACAAACAAA. Deletion right flank: TGCTTGTACGAGAACACATACCATTCCCTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC20050 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20051 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20052 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20053 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20054 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20055 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20056 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20057 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20058 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20059 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC2006 K09A11.1(gk1064) X. C. elegans K09A11.1. Identified by PCR, validated by CGH. External left primer: GAGCAACGAAATTTTGGGAA. External right primer: GTTATGTTTGCCGCGAGATT. Internal left primer: GGAGTATCCGTCCGCAATAG. Internal right primer: TGCAGCTCTCTTTCCATGTG. Internal WT amplicon: 2161 bp. Deletion size: 810 bp. Deletion left flank: TTTGTTCTCCACTCTTTATTCGTATTGAAT. Deletion right flank: GTACGAAGACCAACTAAGAATGGAATTGAA. Insertion Sequence: CTTATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC20060 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20061 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20062 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20063 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20064 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20065 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20067 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20068 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20069 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC2007 nhr-185(gk1066) V. C. elegans This strain is homozygous for a deletion (gk1066) in F47C10.1, detectable by PCR using the following primers. External left primer: TCATTCTGGCAGGAAATTCA. External right primer: GGCGTAACGAAGTCCGATAA. Internal left primer: TCCGGTTAGTCCTGCAATTC. Internal right primer: CTGCTACCCATGTCGAGTGA. Internal WT amplicon: 2231 bp. Deletion size: 1770 bp. Deletion left flank: TTGCAAATTGAACATTGTGTGAAGCTGAGC. Deletion right flank: ATTGAATAGAACAATTTGGTACTAATTGAA. Validation: gk1066 passed by diagnostic PCR and CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC20070 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20072 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20073 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20074 Whole-genome sequenced strain. C. elegans Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its us