Strain Information
| Name | VC4270 View On Wormbase Documentation for VC4270 gk5353 lron-7 |
|---|---|
| Species | C. elegans |
| Genotype | lron-7(gk5353[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. |
| Description | Homozygous viable. Deletion of 1555 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CCATTGTGATGTACACGAAATCGACTGTAG; Right flanking sequence: ACTGGTTGGCTTCATTGCAATCGGAACTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Vancouver KO Group |
| Laboratory | VC |
Sign in
or
register an account if you want to order this strain.