Strain Information
Name | VC3103 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | F38E9.5(gk3181) X. |
Description | This strain is homozygous for a deletion (gk3181) in F38E9.5, detectable by PCR using the following primers. External left primer: GAGCAGCCAAAGGCTCATAC. External right primer: GGCTAGTCTCGGACTGGTTG. Internal left primer: GTGCTTCATTCTGTTCCGGT. Internal right primer: TTCCAATGATTCGAGGGTTC. Internal WT amplicon: 1591 bp. Deletion size: approximately 500 bp. Validation: gk3181 passed by CGH. Deleted probe: GAAGAAAGCATTTAGAAGTTATAGCTTTGGACTAGCATCCGTTTTAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
Mutagen | UV/TMP |
Outcrossed | x0 |
Made by | Vancouver KO Group |
Laboratory | VC |
Sign in
or
register an account if you want to order this strain.