Go to the U of M home page

Caenorhabditis Genetics Center (CGC)

    • Sign In

    Strain Information

    Name VC4092   View On Wormbase
    Species C. elegans
    Genotypeetc-1(gk5182) II.
    DescriptionHomozygous viable. Nonsense allele identified by amplicon sequencing. The gk5182 mutation is C->T, flanking sequences TCGTTCTTTCAGGAGACTATCAAAATGGCT and AGCTACTTGTCAATTTCTATGAAACGAATA.
    MutagenEMS
    Outcrossedx0
    Made byVancouver KO Group
    Laboratory VC
    Sign in or register an account if you want to order this strain.
    • Job Opportunities within the CGC
    • CGC Home
    • Search Strains
    • Register
      (existing labs)
    • Request a Lab Code
      (new labs)
    • Strain List
      • Recently Added Strains
      • Endogenously-tagged Loci
      • Wild Isolates
        (Caenorhabditis sp.)
      • Wild Isolates
        (non-Caenorhabditis sp.)
      • Strain List (text file)
    • Strain Donation
      (Users must be signed in)
    • Request Knockout
      (of Alzheimer's related genes)
    • Lab List
    • Acknowledging the CGC
    • Contact
    • Frequently Asked Questions (FAQs)
    • Conditions Of Use

    • What Is C. elegans?
    • Nomenclature

    • CeNDR - the C. elegans Natural Diversity Resource
    • WormAtlas
    • WormBase
    • National Bioresource Project for the Experimental Animal
      C. elegans
    • WormBuilder
    • WormBook
    • WormBook in Genetics