Strain Information
| Name | VC10079 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | unc-4(e120) mix-1(gk803) II. |
| Description | M106.1. Unc. External left primer: GTTGAGGAAGCAGCTGGAAC. External right primer: TTCTTCGCAGCAGTAATCCC. External WT amplicon: 815 bp. This strain carries a point mutation in M106.1. The mutation is gk803, which is an A->G mutation at R06F6 coordinate 40587 (flanking sequences CACAAAATACCGTAATGACCTCGAATCCCT and ACGAGAGGAACAATTGCTAATGACAAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| Mutagen | UV/TMP |
| Outcrossed | x0 |
| Made by | Vancouver KO Group |
| Laboratory | VC |
Sign in
or
register an account if you want to order this strain.