Strain Information

Name VC4060   View On Wormbase Documentation for VC4060 gk5134 ech-1.1
Species C. elegans
Genotypeech-1.1(gk5134[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
DescriptionHomozygous viable. Deletion of 2429 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTGGTTTTAGCTATAAAATTGTCCTCCA ; Right flanking sequence: TGCGGTAGTGACAAGCAAGGGCGATTTCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
MutagenCrispr/Cas9
Outcrossedx0
Made byVancouver KO Group
Laboratory VC
Sign in or register an account if you want to order this strain.