Strain Information
| Name | VC4085 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | glb-31(gk5173) II. |
| Description | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5173 mutation is G->A, flanking sequences ATATGTAAAAACTCACCTCTTGGAAGTACT and ATCGTTTCCATTGATATGATCCATCCAGAC. |
| Mutagen | EMS |
| Outcrossed | x0 |
| Made by | Vancouver KO Group |
| Laboratory | VC |
Sign in
or
register an account if you want to order this strain.