Strain Information

Name VC2950   View On Wormbase
Species C. elegans
GenotypeY108F1.5(ok3700) X.
DescriptionY108F1.5. Homozygous viable deletion, detectable by nested PCR. External left primer: CACAGCTGAAACCGATGCTA. External right primer: GCCACCACTAGGGAAATTGA. Internal left primer: TCAGGGCATGATGAGAGTCA. Internal right primer: TGGATCAATTTTCAGCCACC. Internal WT amplicon: 1261 bp. Deletion size: 839 bp. Deletion left flank: TTTTTGAAAAACCTACTAATGCCCGCGACT. Deletion right flank: ACTGTAGCCCCAAAAGTACGCAAACACGGA. Insertion sequence at break: CTACCCTAAGAGTCCAGTTTTCAGGTTTCTAGTCGAATTTCGACCAGAATCGGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MutagenEMS
Outcrossedx0
Made byVancouver KO Group
Laboratory VC
Sign in or register an account if you want to order this strain.