Strain Information

Name VC3763   View On Wormbase Documentation for VC3763 gk3721 EEED8.12
Species C. elegans
GenotypeEEED8.12(gk3721[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
DescriptionHomozygous viable. Deletion of 264 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAATTGTAGAGTTAAAATCTACATTTCCA; Right flanking sequence: CAGAAGGGAAACCATAAATAACGATGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
Made byVancouver KO Group
Laboratory VC
Sign in or register an account if you want to order this strain.