Strain Information
| Name | VC4114 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | C01A2.6(gk5192) I; F25B5.3(gk5193) III. |
| Description | Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT. |
| Mutagen | EMS |
| Outcrossed | x0 |
| Made by | Vancouver KO Group |
| Laboratory | VC |
Sign in
or
register an account if you want to order this strain.