Strain Information

Name VC10123   View On Wormbase
Species C. elegans
GenotypeR11G1.6(gk1190) X.
DescriptionR11G1.6. External left primer: GAGACGTTGAAGTACGCGCT. External right primer: CCGAAAATTCGAAAGCGTAA. Internal left primer: TTACCCAGAGACCGAACTGC. Internal right primer: CTTCATCGCCCTCTTTCCTT. Internal WT amplicon: 838 bp. Deletion size: approximately 200 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: AAAGGATCACCCACAGCATCTCTCCAAACAGCCAACCCAAAACTAAAATT. Left deleted probe: AAAACAATGAGTACGGATTCAAAAATAAAACCTTGTAGGAAACTTGTGTA. Right deleted probe: GGATTCGATGGCATCTGTATAGAGTTGAATGGCATAATTATAGGCATTTA. Right flanking probe: GAAGCGATTCGAATCGTTCTCCCGACAACATCTTAGGAACAACGGCCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MutagenUV/TMP
Outcrossedx0
Made byVancouver KO Group
Laboratory VC
Sign in or register an account if you want to order this strain.