Strain Information
Name | VC2181 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | C54E4.2(gk1083) IV; alh-2(gk3053) V. |
Description | K04F1.15, C54E4.2. The allele gk1083 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 575 bp. Deletion left flank: TGAATACCGTTAATTTTTTTTTTTTAATTA. Deletion right flank: TTCGCTGAAAAATATAATTTCTTTCTGGTG. The allele gk3053 was identified by CGH and not confirmed by PCR. Left flanking probe: ATTTTACATTAGTCCGTGAATTTCAGATACTACGCCGGATATGCTGATAA. Right flanking probe: GCGCGGGATCAGTTTGGGTCAACTGTTATGATGTTTTTGATCCTGCTGCT. Left deleted probe: TATGCTGATAAAAACCACGGAAAAACCATTCCCGTCGGTGGAGACTATTT. Right deleted probe: TGAATAAAGCTCTTCAAGTCGCAAATACTATCCGCGCGGGATCAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
Mutagen | UV/TMP |
Outcrossed | x0 |
Made by | Vancouver KO Group |
Laboratory | VC |
Sign in
or
register an account if you want to order this strain.