Strain Information

Name VC2028   View On Wormbase
Species C. elegans
Genotypelntl-1(ok1824) IV.
DescriptionC31H1.6. External left primer: CCAAAGTCTCCTGCCCATTA. External right primer: ACATACCACCCGCTTTCTTG. Internal left primer: TTCAAACAATGATACCCGCA. Internal right primer: TTTTGAGGGAAATGCGAAAC. Internal WT amplicon: 2666 bp. Deletion size: 1550 bp. Deletion left flank: TTACAGGTCCATCAAAGCGGAATCCTTTAG. Deletion right flank: TTTTTGTTCAGGAAACTTTGAAACGCACAT. Insertion Sequence: TACGGACCTCGTTTGAATTTCAATCATCTTCATCAGCAACAACAGTTGCAGTGAGTTTT TGGGAAAATTTTTTTGAAAGTATAAATATTCGTTTTAGTTCAACAATCATTCCTTCGGA GTATCTCGGAGACAAGTCAGGATTTGAGTCCAGGTAAGGGATGAAGAAGGCAATTCCAA AAAATTTTTAAACAAAAAACGACTGTTTCACGGTGCTATTATAACAAAACCATATGAAT GTGATTTGGTTCGAACCATGCCTTTGCCATTTTTAAAACATCATTATAAATAGTTCTGC AAATTAATATTACAGAACTCTTCCATCGGAATCTATTATGTCAGCCAACAGCAGCAGTC TTGGATCTCACTGGAAGAGAATTGATTCGTTCACTAGTGGAAAATCTACCCAATCAATT CCCACTACAATTTCTTCGAAACCTCTAACTATTCCTTCATCGATTTCTGCCAACACCGC TTCCATCCCACCAAATCATGGTTCAGAATTTTCGAAAGATTTCAAGATGTCATCCTCAT CGAGCATGACTAGTGAGTATTCGGAAACCATCCATGGAAACTCGTTGGCATCTCTGGCT CCATCGTCACAAATATTGAGCTCTTTGGTTGAAACTACTGAGAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MutagenUV/TMP
Outcrossedx1
Made byMark Edgley
Laboratory VC
Sign in or register an account if you want to order this strain.