Strain Information

Name VC2144   View On Wormbase
Species C. elegans
GenotypeT24F1.2(gk3219) II; T26A8.4(gk3176) IV; ubc-17(gk3220) X.
DescriptionThis strain is homozygous for a deletion (gk3176) in T26A8.4, detectable by PCR using the following primers. External left primer: TGCTTTGGCTCTTCTTGGAT. External right primer: TGTTTGCGCTGAGAGAGAGA. Internal left primer: GCTGAACTAATCCAGGCTGC. Internal right primer: TCCAACGTTCAAGATTCCAA. Internal WT amplicon: 1977 bp. Deletion size: approximately 625 bp. Validation: gk3176 passed by CGH. Left deleted probe: TTGCGGTGGCTGAACTAATCCAGGCTGCTGAAGATGTGGATGTTGAATTG. Right deleted probe: AAACTAACCTTTTTACAAAAACTATTAGCATAAAAGTTGCACAGAACAGG. Other deletions (gk3219, gk3220) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
Made byVancouver KO Group
Laboratory VC
Sign in or register an account if you want to order this strain.