Strain Information
Name | VC4084 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | T27E7.4(gk5171) IV; irk-2(gk5172) X. |
Description | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5171 mutation is G->A, flanking sequences CTCTGATAATAAAACATTTGTAAAGTGTTC and AATGATATTTTTCGTTGCAGATTGTTTTTT. The gk5172 mutation is T->C, flanking sequences GACGCTTTCCACCACTCCTTCCAAAATTGC and GAAAATTTGAAAACATTTGGATTTTCTATT. |
Mutagen | EMS |
Outcrossed | x0 |
Made by | Vancouver KO Group |
Laboratory | VC |
Sign in
or
register an account if you want to order this strain.