Strain Information
| Name | VC10109 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | K05F6(gk907) unc-4(e120) II. |
| Description | K05F6.2. Unc. External left primer: ACAAATTCCCTTTGTCGTCG. External right primer: TGGATGAGCAGCTGGTAAGA. External WT amplicon: 200 bp. This strain carries a point mutation in K05F6.2. The mutation is gk907, which is a T->A mutation at K05F6 coordinate 21364 (flanking sequences AAATCAAAAACTCTGTTTGATGGATATCTA and ATGCCTTTAAATGATCTACTTCTTACCAGC). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| Mutagen | UV/TMP |
| Outcrossed | x0 |
| Made by | Vancouver KO Group |
| Laboratory | VC |
Sign in
or
register an account if you want to order this strain.