Strain Information

Name VC2342   View On Wormbase
Species C. elegans
GenotypeY37F4.6(gk1166) I.
DescriptionY37F4.6. External left primer: CAGAAGTTTGTGGGTTCGGT. External right primer: ACCTGCCTACGTGCCTAGAA. Internal left primer: ACTCCATATCTCCGCAGGAA. Internal right primer: TCCTGGTCCATCTTCGAGTT. Internal WT amplicon: 2083 bp. Deletion size: 990 bp. Deletion left flank: TGAACACTTTTTTGTAAAAAATTTGGTTGC. Deletion right flank: CACGAGGGGCGTGGCCAACGACAATGATTG. Insertion Sequence: CGAGTTGGAACCAATTGATTTGAGCTTCATTATTTTTGAATATTCTAAATAGTTAAAGG TCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MutagenUV/TMP
Outcrossedx0
Made byVancouver KO Group
Laboratory VC
Sign in or register an account if you want to order this strain.