Strain Information
| Name | VC381 View On Wormbase Documentation for VC3810 gk3778 EEED8.4 |
|---|---|
| Species | C. elegans |
| Genotype | atm-1(gk186) I. |
| Description | Y48G1BL.2. Superficially wild type. [NOTE: According to WormBase, gk186 is a 548 bp deletion. Left external: gtcgggttttgatgcacttt Right external: atctttccatcgtttccacg Left internal: aaattcgatttttcgcgatg Right internal: caattgacgcaatttgcact] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| Mutagen | UV/TMP |
| Outcrossed | x0 |
| Made by | Mark Edgley |
| Laboratory | VC |
Sign in
or
register an account if you want to order this strain.