Laboratory Information
| Name | PS View on WormBase |
|---|---|
| Allele designation | sy |
| Head | Paul W Sternberg |
| Institution | California Institute of Technology, Pasadena, CA |
| Address | California Institute of Technology MC 140-18 1200 E. California Blvd. Pasadena 91125 United States |
| Website | http://wormlab.caltech.edu/ |
| Gene classes | apt ark bac brp cccp cod cog cyl dnj fos goa gpa gpb gqa hcd ipp lfe lov maea nsh pepm pkd polq pqn prc raf rok sli sno son sos tpra trp ubl vex wrb zbed lnkn piit rmrp rsef |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| JT47 | egl-8(sa47) V. | C. elegans | |
| PS10001 | F49B2.6(sy2028) I. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F49B2.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagCGATCTGGACGCCCAGCAACCCCTACCGCCA. Right flanking sequence: CACCTCATCCCACCGTCGAACCCGTGTATGTGTCG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACGGTGGGATGAGGTGTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10012 | F31E8.4(sy2030) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F31E8.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATTCTCTTCAGCTGGTGGAAAACTGGATCTCT. Right flanking sequence: GTCTGgtaagtctatatacttcggacacattcaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGAAAACTGGATCTCTGTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10014 | F54G2.1(sy2032) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F54G2.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cctgccaaaccgatgttttattgcagAGTCCAAGC. Right flanking sequence: GTCAGATGGGAACTTTTTCGAAAAAGTAACTGCTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGTTCCCATCTGACGCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10016 | F53A10.2(sy2034) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53A10.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gatcATGTTCCACGTGTCAACAATGCTACCGTATAC. Right flanking sequence: TATTGGAGACGCCCAGCAGCTTCAAAGAAAACGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAATGCTACCGTATACTAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10018 | F36G3.3(sy2036) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F36G3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGATTACGCACCCACACAGCCCGTGTACCATCC. Right flanking sequence: AAGCAGTCATGTAACAGCTCCACCGTACCATTACC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGTTACATGACTGCTTGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10020 | F53H1.3(sy2038) IV. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53H1.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGCCGGATATTGAGCCATGGGACCGGTTTCGC. Right flanking sequence: GACTGGCTTCACTGCATTTGTGTGGTCACGTTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATGGGACCGGTTTCGCGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10022 | F56F10.1(sy2040) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F56F10.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cttttttgaattctagTCACCATTTGGACCGGTT. Right flanking sequence: AACAGCGTCTGATGGGGCAAGCATTCAAGAGACTTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCCCATCAGACGCTGTTAAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10060 | F58G6.3(sy2042) IV. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F58G6.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATAATTCAATGGATATGGACATGAATCAAGGACCTTTC. Right flanking sequence: ATGTGGATGTGGTTTCATACAAAACCACAAGAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAAACCACATCCACATGAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10062 | M03C11.1(sy2044) III. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of M03C11.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCTTCAGCATTTTTCAGTCATACGGAGCATT. Right flanking sequence: GGGCGGGGAGCTTTTGGAAAAgttagttggttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTCATACGGAGCATTGGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10064 | R12C12.5(sy2046) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAGGAGAAGATCAAGGAAAAAAGCCGTAAGA. Right flanking sequence: GGAAGGCTCCAACTGCAGATGAAGCAATTGGAAATTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAAAAAAGCCGTAAGAGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10066 | F59C12.3(sy2048) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F59C12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAGCGACGAGTGCATGCAGTGCCACCGACACCCATGT. Right flanking sequence: ATCAGGGAGAGACGAACATTTTAGACTCACTTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCACCGACACCCATGTATC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10068 | R08E3.3(sy2050) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R08E3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTTTCATCAGAGACGCTTGCCGACATCTT. Right flanking sequence: GAGTGgtatgttttttgtctgaaatctaattttattc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGCTTGCCGACATCTTGAG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS1009 | unc-101(sy237) I; sli-1(sy143) X. | C. elegans | This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS10155 | T05C3.6(sy2066) V. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCATTCAATAGTTGCTATTGTGGCAGTGATTATAA. Right flanking sequence: CAACGGCAATATGGCTCACGgttagtttaaatatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGGCAGTGATTATAACAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10157 | R12C12.6(sy2068) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGATGCATTTCTTGCAAATTGCGACTGCCGTTA. Right flanking sequence: TGAGTCACGAAACACTGTGCTCTTAAAAGTAGTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTGTTTCGTGACTCATAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10158 | T05E12.3(sy2069) V. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATATTTTTAATATTTTTTATTTTTCGACTCCAGGC. Right flanking sequence: GCAAGgtaagtaagaattattgttttttatttatt. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCTTACTTACCTTGCGCC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10160 | T05E7.3(sy2072) I. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E7.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAAAGAAGCAGAGATAATTAATGGTGAAACCAGAA. Right flanking sequence: TGGATGTGAACAGAACATCCGAACTCGAGgtttta. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTCTGTTCACATCCATTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10162 | nlp-50(sy2074) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-50. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gcagtttcacacaaaccATGCGCTTCTCCGTCT. Right flanking sequence: TTGTTGCTCTATTTGCTCTTCTTGCTGTCTCTTATG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCAAATAGAGCAACAAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10163 | T08G3.13(sy2075) V. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T08G3.13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctattttgattgaattATGTCTGTTATCGAGTTATGTGT. Right flanking sequence: CGGAGGACAGAAGTTCACAACGACGAAAACTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATCGAGTTATGTGTCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10165 | nlp-51(sy2053) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtttttcttcagtttcaaatcaaaATGCGATTCCTCA. Right flanking sequence: TCTTGGCTCTCCTCGTGCTCTTCGCCATCACCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAAATGCGATTCCTCATCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS10170 | gldi-2(sy2058) II. | C. elegans | T13C2.6. Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of gldi-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTGATTTCAATGGCCACCATTTCGGTGGGCCTCCA. Right flanking sequence: ACCGATGGGAGCACCTACAAGAAgtatgttttc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAGGTGCTCCCATCGGTTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS1032 | syDf1/unc-2(e55) lon-2(e678) X. | C. elegans | Heterozygotes are Lon non-Unc. Df/Df is embryonic lethal. Maintain by picking single Lon non-Unc and check for dead embryos-->Lon non-Unc recombinants that have lost the Df arise frequently. Does not survive long periods of starvation-->survivors tend to be Lon non-Uncs without the Df. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1056 | hIn1 [unc-101(sy241)] I. | C. elegans | Unc. Previously described as hC1 (hC1 also known as hIn1). This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS10640 | cmk-1(sy2277[cmk-1::mKate2::AID*::3xFLAG) IV; syIs875. | C. elegans | syIs875 [ins-6p::dYFP + ins-6::mCherry + unc-122p::GFP]. cmk-1(sy2277) is a C-terminal knock-in of mKate2::AID::FLAG to be used for conditional degradation of CMK-1 protein. sy2277 is a CRISPR-engineered allele generated using the self-excising cassette (SEC) method (Dickinson et al. 2015, Genetics) with the gRNA sequence 5'-AGCGTGAAAAGCGGGTGTAGNGG-3' (note: NGG not included in the gRNA). syIs875 is an integrated transgene that includes a transcriptional and translational reporter for ins-6 and is marked by GFP in the coelomocytes. dYFP signal can be seen in ASI during reproductive growth and in ASJ (strong) and ASI (weaker) during dauer exit. Reference: Zhang MG, et al. (2024). Available at: https://www.biorxiv.org/content/10.1101/2024.03.20.586022v1 [Accessed 13 August 2024]. |
| PS1123 | unc-31(e169) IV; syIs1 X. | C. elegans | syIs1 [lin-3(genomic) + rol-6(su1006)]. Animals are Muv due to overexpression of lin-3. Unknown if unc-31(e169) is present in this strain. See also WBPaper00004853. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1162 | Panagrolaimus sp. | Panagrolaimus sp. | Wild-type Panagrolaimus isolated in Beijing, China, 1991. Male-female strain. |
| PS1163 | Panagrellus redivivus wild isolate. | Panagrellus redivivus | Panagrellus redivivus. Not hermaphroditic. Sexes separate. Growth Slow. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1258 | sli-1(sy129) X. | C. elegans | Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1259 | sli-1(sy263) X. | C. elegans | Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1378 | itr-1(sy290) lin-3(n1058) IV. | C. elegans | This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1410 | let-23(sy15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1411 | let-23(sy1) II; sli-1(sy143) X. | C. elegans | sli-1 is a silent suppressor of the Vul phenotypes of let-23(lf) mutants. sy1;sy143 animals are Hyperinduced. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1423 | let-23(sy17) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Reference null allele for let-23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1427 | syIs6. | C. elegans | syIs6 [hsp-16.41p::lin-3]. Chromosomal insertion of the extrachromosomal array syEx23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1461 | ark-1(sy247) IV. | C. elegans | WT at 20C. At 25C, occasional animals with hyperinduced vulva are observed. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1478 | unc-3(e151) lin-15B&lin-15A(e1763) X. | C. elegans | Unc. Muv. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1493 | dpy-20(e1362) IV; syIs9. | C. elegans | syIs9 [pJMGoQL + (pMH86) dpy-20(+)]. Phenotype of dominant activated Go alpha is lethargic and egg-laying defective - phenotype increases in severity as animal matures and ages. Animals frequently wander to the side of the plate. Animals move with decreased amplitude of sinusoidal waves. Dpy and WT revertants are frequent. Linkage unknown. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1524 | let-23(sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | 10% of heterozygotes are Muv, 90% are WT. Segregates UncMuv and DpyUncs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1595 | lfe-2(sy326) I; lin-3(n1058) dpy-20(e1282) IV. | C. elegans | sy326 suppresses the sterility of n1058. Dpy. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1631 | itr-1(sy290) dpy-20(e1282) IV. | C. elegans | This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1678 | mut-2(?) goa-1(pk62) I. | C. elegans | |
| PS1681 | dpy-20(e1282) IV; syIs17. | C. elegans | syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)]. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1702 | dpy-20(e1282) IV; syIs20 him-5(e1490) V. | C. elegans | syIs20 [gpa-1::lacZ + dpy-20(+)] V. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1839 | let-23(sa62) II. | C. elegans | Semi-dominant Muv. |
| PS1922 | dpy-20(e1282) syIs24 IV. | C. elegans | syIs24 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2037 | syIs12 II. | C. elegans | syIs12 [hsp::lin-3 + dpy-20(+)]. "low dose" overexpressor of the EGF repeat of lin-3 under control of the heat shock promoter. Wild type vulval differentiation when grown at 20C. Muv phenotype resulting from heat shock at L2 lethargis. Reference: Katz WS, et al. Cell. 1995 Jul 28;82(2):297-307. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS21 | let-23(sy1) II; him-5(e1490) V. | C. elegans | Viable allele of let-23. Vul. Throws males. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2105 | dpy-20(e1282) IV; syIs13. | C. elegans | syIs13 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2109 | dpy-20(e1282) IV; syIs25 X. | C. elegans | syIs25 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2286 | unc-38(x20) lfe-2(sy326) I. | C. elegans | Fertile Unc-38. sy326 has no phenotype on its own. Suppresses sterility of let-23(sy10) and lin-3(n1058). Sterile in double mutant combination with lfe-1 alleles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2366 | itr-1(sy328) unc-24(e138) IV. | C. elegans | Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2368 | itr-1(sy327) unc-24(e138) IV. | C. elegans | Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2399 | dpy-20(e1282) IV; syIs30 X. | C. elegans | syIs30 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2442 | dpy-20(e1282) IV; syIs44 V. | C. elegans | syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Non-Dpy. Upon heat shock, two intense spots of nuclear fluorescence due to lacO in the chromosome, and a diffuse nuclear fluorescence due to nuclear-localized GFP-lacI. Array derived from Fire Lab vector pPD49-78 and dpy-20 rescuing construct pMH86. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2444 | dpy-20(e1282) IV; syIs36. | C. elegans | syIs36 [(pLB2) egl-30(+) + pBS + (pMH86) dpy-20(+)]. Integrated version of syEx126 (egl-30 over-expressing line). Easily reverted. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2467 | dpy-20(e1282) IV; syEx178. | C. elegans | syEx178 [hsp16.1::egl-5 + (pMH86) dpy-20(+) + pBS]. Heat-shock egl-5. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2512 | itr-1(sy331) unc-24(e138) IV. | C. elegans | Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2516 | itr-1(sy291) unc-24(e138) IV. | C. elegans | Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2571 | cog-1(sy275) II. | C. elegans | Egl, Pvl, Cog (connection to gonad defective). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2582 | itr-1(sy290) unc-24(e138) IV. | C. elegans | Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2627 | dgk-1(sy428) X. | C. elegans | Pale, scrawny appearance, probably due to starvation. Hyperactive, backs frequently, egg laying constitutive, slow pharyngeal pumping. Probably null (based on sequence, S. Nurrish). Suppresses activated GOA-1 and partially suppresses egl-3(rf). Lethal in combination with eat-16(rf). Previously called sag-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2670 | klp-6(sy511) III; him-5(e1490) V; syIs33. | C. elegans | syIs33 [gpa-1::GFP]. Labels the spicule neurons in males. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2728 | sli-1(sy143) X. | C. elegans | Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2746 | dpy-20(e1282) IV; syEx234. | C. elegans | syEx234 [let-23::GFP + pBS + (pMH86) dpy-20(+)]. Non-Dpys bear the transgene and express GFP in multiple cells including the pn.ps and uv1. Maintain by picking Non-Dpy. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2767 | hmg-1.2(sy549) III; dpy-20(e1282) IV; syIs20 him-5(e1490) V. | C. elegans | syIs20 [gpa-1::lacZ + dpy-20(+)] V. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2943 | hmg-1.2(sy549) unc-32(e189) III; syIs20 him-5(e1490) V. | C. elegans | syIs20 [gpa-1::lacZ + dpy-20(+)] V. Unc. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS295 | let-23(sy97) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS2958 | syIs46 II; ncl-1(e1865) III; dpy-20(e1282) IV; him-5(e1490) V. | C. elegans | syIs46 [dpy-30::S65T::lacI + hsp-16p::GFP::lacI + dpy-20(+)] II. Animals are Ncl, Him and Non-Dpy. Heat shock results in diffuse nuclear GFP expression from Fire Lab vector pPD49.78::LacI in most cells. Also see some consitutive GFP expression in embryos from dpy-30 promoter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3003 | dpy-20(e1282) ark-1(sy247) IV. | C. elegans | Dpy. WT vulva at 20C. At 25C, occasional animals with hyperinduced vulva are observed. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS302 | let-23(sy10) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS312 | Pristionchus pacificus wild isolate. | Pristionchus pacificus | WT strain, Pristionchus pacificus. Hermaphroditic. See also WBPaper00002887. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3151 | lov-1(sy552) II; him-5(e1490) V. | C. elegans | Hermaphrodites are WT. Males are defective in response and vulva location mating behaviors. Low mating efficiency with non-Unc hermaphrodites. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3170 | dpy-17(e164) hmg-1.2(sy549) III; syIs20 him-5(e1490) V. | C. elegans | syIs20 [gpa-1::lacZ + dpy-20(+)] V. Dpy. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3232 | cyl-1(sy433) V. | C. elegans | Appears WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3233 | affl-2(sy509) III. | C. elegans | Defects in egg laying. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3239 | dpy-20(e1282) syIs49 IV. | C. elegans | syIs49 [zmp-1::GFP + (pMH86) dpy-20(+)] IV. Non-Dpy. Expresses GFP in anchor cell at L3 stage. VulA at late L4, and VulE soon thereafter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3351 | dpy-20(e1282) syIs17 IV. | C. elegans | syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)] IV. Non-Dpy animals which at all stages progressively exhibit Go(gf) phenotype after heat shock treatment (standard treatment is 33C water bath for 30 minutes). Animals cease feeding, foraging, locomotion, ovulating and egg laying. Gravid adults eventually bag. "Suicides" are common. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3352 | syIs50. | C. elegans | syIs50 [cdh-3::GFP + dpy-20(+)]. Line is a slightly Dpy, but appears healthy. Reference: Pettitt J, et al. Development. 1996 Dec;122(12):4149-57. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3398 | lov-1(sy582) II; pkd-2(sy606) IV; him-5(e1490) V. | C. elegans | Double mutant phenotype resembles that of the single mutants. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3401 | lov-1(sy582) II; him-5(e1490) V. | C. elegans | Hermaphrodites are WT. Males are defective in response and vulva location mating behaviors. Low mating efficiency with non-Unc hermaphrodites. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3411 | cog-1(sy607)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, DpyUncs and Pvul Sterile cog-1 homozygotes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3465 | unc-38(sy576) unc-29(e1072) I; unc-64(e246) III; him-5(e1490) V. | C. elegans | Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3475 | unc-119(ed4) III; syIs51 V. | C. elegans | syIs51[cdh-3::CFP + unc-119(+)] V. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3476 | unc-119(ed4) III; syIs52 X. | C. elegans | syIs52[cdh-3::cfp + unc-119(+)] X. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3504 | syIs54 II; unc-119(ed4) III. | C. elegans | syIs54 [ceh-2::GFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3506 | syIs56 V. | C. elegans | syIs56 [ceh-2::YFP + unc-119(+)] V. Expressed in vulB and vulC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3517 | unc-119(ed4) III; syIs57 X. | C. elegans | syIs57 [cdh-3::CFP + unc-119(+)]. Unsure if unc-119(ed4) remains in the background. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3525 | syIs59 X. | C. elegans | syIs59 [egl-17::CFP + unc-119(+)] X. Expressed in vulC and vulD. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3526 | syIs60 II; unc-119(ed4) III. | C. elegans | syIs60 [F47B8.6::GFP + unc-119(+)] II. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3527 | syIs61 V. | C. elegans | syIs61[F47B8.6::GFP + unc-119(+)] V. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3528 | syIs51 V; syIs55 X. | C. elegans | syIs51 [cdh-3::CFP + unc-119(+)] is expressed in vulC, vulD, vulE and vulF. syIs55 [ceh-2::YFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3551 | hsf-1(sy441) I. | C. elegans | Defects in egg laying. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3653 | ipp-5(sy605) X. | C. elegans | Subtle ovulation defect which is viewable by Nomarski - 2 oocytes ovulate (pass into uterus) at the same time. Double mutants with lfe-2(sy326) and lfe-1(sy290) show sterility. Double mutant with lin-3(n1058) is fertile. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3662 | syIs63. | C. elegans | syIs63 [cog-1::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3664 | unc-119(ed4) III; syIs65 IV. | C. elegans | syIs65 [pT100.18(B0034.1::pes-10::GFP) + unc-119(+)] IV. unc-119(ed4) may have been crossed out. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3665 | syIs66 II; unc-119(ed4) III. | C. elegans | syIs66 [B0034.1::pes-10::GFP + unc-119(+)] II. Expressed in vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3666 | syIs67 V. | C. elegans | syIs67 [zmp-1::pes-10::cfp + unc-119(+)]V. Expressed in vulA and vulE. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3667 | unc-119(ed4) III; syIs68 IV. | C. elegans | syIs68 [zmp-1::pes-10::CFP + unc-119(+)] IV. Expressed in vulA and vulE. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3720 | unc-119(ed4) III; syIs75. | C. elegans | syIs75 [lin-18::GFP + unc-119(+)]. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3721 | syIs76 IV. | C. elegans | syIs76 [zmp-1::pes-10::CFP + unc-119(+)] IV. Expressed in vulA and vulE. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3722 | unc-119(ed4) III; syIs101 IV. | C. elegans | syIs101[T04B2.6::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3724 | unc-119(ed4) III; syIs102 X. | C. elegans | syIs102[T04B2.6::cfp + unc-119(+)] X. Expressed in vulB and vulD. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3728 | syIs77 II. | C. elegans | syIs77 [zmp-1::pes-10::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3729 | unc-119(ed4) III; syIs78. | C. elegans | syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3747 | ipp-5(sy605) X; syEx429. | C. elegans | syEx429 [ipp-5p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Construct pIP5 contains 2.0 kb promoter fragment upstream of ipp-1 driving GFP expression in distal spermatheca (in adults); pharynx and vulva (all stages). [NOTE: the syEx429 array in this strain was previously incorrectly annotated as carrying ipp-1p::GFP. The array contains an ipp-5p::GFP transgene.] This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3800 | egl-19(n582) IV; him-5(e1490) V; syEx468. | C. elegans | syEx468 [myo-3p::egl-19::GFP]. C-terminal GFP fusion. Pick GFP+ to maintain. |
| PS3802 | unc-38(sy576) I; him-5(e1490) V; syEx470. | C. elegans | syEx470 [myo-3::unc-38::GFP]. Pick GFP+ to maintain. unc-38::GFP transgene produced by in vivo recombination between pR29 (myo-3p::unc-38) and pR26 (unc-38::GFP). |
| PS3808 | unc-119(ed4) syIs80 III. | C. elegans | syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. GFP expression in developing vulval cells, VCs and uterine pi lineage cells. Received new stock 9/2003. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Received new strain from Bhagwati Gupta on April 7, 2008. |
| PS3818 | unc-68(r1158) him-5(e1490) V; syEx475. | C. elegans | syEx475 [myo-3p::unc-68(see following comments) + myo-2p::GFP + pUC-19]. Pick GFP+ animals to maintain. myo-3p::unc-68 transgene was produced by injecting pEM23 (myo-3 promoter + unc-68 exons 1-8) + 18 kb unc-86 PCR fragment (start codon through nucleotide 18090) + pLM511 (unc-68 position 11989 to the end); fragments were recombined in vivo. |
| PS3931 | ref-1(ok288) II. | C. elegans | P9.p and P10.p fail to fuse with hyp7 during L1 in hermaphrodites. Misshapen head (low penetrance) and ectopic postdeirid generated by V6 (low penetrance). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3972 | unc-119(ed4) syIs90 III. | C. elegans | syIs90 [egl-17::yfp + unc-119(+)] III. Expressed in vulC and vulD. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3976 | lin-17(en671) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); lin-18(e620) X. | C. elegans | Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile en671 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. |
| PS4064 | let-23(sy621sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are approx. wild-type in size and Muv. Pick Muv non-Unc (heterozygotes) to maintain. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4076 | egl-46(sy628) him-5(e1490) V; lin-15B&lin-15A(n765) X. | C. elegans | Him. |
| PS4087 | dpy-22(sy622) X. | C. elegans | Enhances vulval development in the presence of let-23(sa62gf) in hermaphrodites and males. Animals are Dpy. Hermaphrodites are Egl. Males have abnormal ray development. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4110 | kfIs1. | C. elegans | kfIs1[plc-1::GFP]. GFP is expressed in the adult hermaphrodite spermatheca. |
| PS4112 | plc-1(rx1) X; kfEx2. | C. elegans | kfEx2 [plc-1(+) + sur-5::GFP]. Pick GFP+ animals to maintain. plc-1(rx1) homozygotes are semi-Sterile. Animals with the array have normal brood size. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4226 | unc-119(ed4) III; syIs53 V. | C. elegans | syIs53 [pPGF11.07(lin-11::GFP) + unc-119(+)] V. GFP expression in developing vulval cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4230 | unc-103(sy557) III; him-5(e1490) V. | C. elegans | Semi-dominant. 60% of adult males will have protruding spicules; Prc (protraction constitutive) phenotype. Larval animals and adult hermaphrodites do not display any gross abnormal phenotypes. Prc males have a mating efficiency of 0. Non-Prc males have a mating efficiency of 3. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4263 | egl-30(md186) I; dpy-20(e1282) IV; syIs105. | C. elegans | syIs105 [egl-30::GFP + dpy-20(+)]. Translational fusion contains all of the presumptive 5'-transcriptional regulatory sequences, introns, and presumptive 3 regulatory sequences for egl-30, in addition to the coding sequences for GFP just 5' of the egl-30 initiating methionine. syIs105 was found to partially rescue egl-30(md186) with respect to egg laying, movement, pharyngeal pumping, and response to neurotransmitters in egg-laying assays. |
| PS4264 | egl-30(sy676md186) I; him-5(e1490) V. | C. elegans | Males mate better as heterozygotes. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS427 | lin-45(sy96) IV. | C. elegans | Vulvaless. 90% of the progeny are larval lethal-most die as L1s. Males are mating defective. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4308 | unc-119(ed4) III; syIs107. | C. elegans | syIs107 [lin-3(delta pes-10)::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4309 | unc-119(ed4) III; syIs108. | C. elegans | syIs108 [lin-3(delta pes-10)::GFP + unc-119(+)]. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4330 | spe-41(sy693) III; him-5(e1490) V. | C. elegans | Brood size 13.5 Brood size may increase after many passages. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS436 | let-60(sy93) IV. | C. elegans | Dominant Vul (>99% Egl). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4411 | unc-119(ed4) III; syIs123 X. | C. elegans | syIs123[unc-119(+) + fos-1a::YFP-TL]. Integration of functional fos-1a tagged with YFP at the N-terminus. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS443 | Panagrolaimus sp. wild isolate. | Panagrolaimus sp. | Armenian worm. Male/Female strain. Maintain by mating. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4432 | him-5(e1490) V; dpy-22(sy665) X. | C. elegans | Enhances vulval development in the presence of let-23(sa62gf) in hermaphrodites and males. Animals are Dpy. Hermaphrodites are Egl. Males have abnormal ray development. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4441 | syIs118 I; unc-119(ed4) III. | C. elegans | syIs118 [fos-1a::YFP-TX + unc-119(+)]. YFP inserted into Sal site seven amino acids down stream of start ATG of Cel-fos-L transcript. YFP from plasmid PPD136.64 (Andy Fire's 1999 kit). Promoter is from nucleotide 529 to 8110 of cosmid F29G9. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4444 | unc-119(ed4) syIs129 III. | C. elegans | syIs129 [hemicentin(delta SP)::GFP + unc-119(+)]. Integrant of hemicentin::GFP reporter where the signal has been deleted. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4558 | unc-119(ed4) syIs137 III. | C. elegans | syIs137 [unc-119(+) + fos-1b::CFP-TX]. Integrant of fos-1b transcriptional reporter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4627 | let-60(n1046) unc-31(e169) V/nT1 [let(m435)] (IV;V). | C. elegans | Maintain by picking WT. Segregates Muv Unc (let-60 unc-31 homozygotes), wild-type heterozygotes and dead eggs. Reference: Moghal N, Sternberg PW. Development. 2003 Jan;130(1):57-69. |
| PS4657 | him-5(e1490) V; syIs78. | C. elegans | syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Not sure if unc-119(ed4) from the parent strain is still present. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS468 | let-60(sy100) dpy-20(e1282)/let-60(n1046) unc-22(s7) IV; him-5(e1490) V. | C. elegans | Heterozygotes are weak Muv and segregate weak Muv, Muv Twitchers, and Dpy Vuls whose progeny are larval lethal. sy100 is a dominant negative allele of let-60. n1046 is a gain-of-function allele of let-60. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4757 | bed-3(sy702) IV. | C. elegans | |
| PS4758 | bed-3(sy705) IV. | C. elegans | |
| PS4867 | syIs146. | C. elegans | syIs146 [mom-2::GFP + unc-119(+)]. May contain unc-119(ed4). This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4886 | plc-3(tm1340)/mIn1 [mIs14 dpy-10(e128)] II. | C. elegans | Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm1340 homozygotes (sterile). This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4997 | unc-119(e2498) III; syIs179. | C. elegans | syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS5131 | let-23(sy12)/mIn1 [mIs14 dpy-10(e128)] II. | C. elegans | Heterozygotes are GFP+. mIn1 homozygotes are Dpy and GFP+. let-23(sy12) homozygotes are non-GFP. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS524 | let-60(sy100) dpy-20(e1282) IV/nT1 [let-?(m435)] (IV;V). | C. elegans | Heterozygotes are non-Dpy Vul and segregate non-Dpy Vul, DpyVul whose progeny are dead, and dead eggs. sy100 is dominant Vul and recessive Lethal with maternal rescue: homozygotes from heterozygous mothers grow to adulthood and become a bag of dead larvae. sy100 is not 100% penetrant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS529 | unc-101(sy108) I. | C. elegans | Unc. Suppresses the Vul phenotypes of let-23(lf) mutants. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS5332 | unc-119(ed4) III; him-5(e1490) V; syIs187. | C. elegans | syIs187 [pes-10::7XTCF-mCherry-let-858(3'UTR) + unc-119(+)]. Cherry POPTOP. POPTOP expression is best visualized using the mCherry/Texas Red filter. POPTOP transgenes display background expression. POPFOP(sy974) is the control plasmid with mutated binding sites. Analysis of POPFOP should always be used to subtract background expression. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS536 | unc-24(e138) let-60(sy99) IV/nT1 [let-?(m435)] (IV;V). | C. elegans | Heterozygotes are Vul (97% Egl). Segregates dead eggs. sy99 homozygotes are lethal. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS538 | unc-24(e138) let-60(sy92) IV/nT1 [let-?(m435)] (IV;V). | C. elegans | Heterozygotes are Vul and segregate Vul, Unc-24 lethals and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS5527 | pop-1(q645) I/hT2 [bli-4(e937) let-?(h661)]; syIs187. | C. elegans | syIs187 [unc-119(+) + POPTOP]. Heterozygotes are WT and segregate WT and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS5531 | Cbr-daf-2(sy5445). | C. briggsae | This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS5551 | pry-1(mu38)/hIn1 [unc-54(h1040)] I; syIs188. | C. elegans | syIs188 [POPTOP + unc-119(+)]. Maintain by picking non-Uncs. syIs188 suppresses pry-1(mu38) Muv phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS5552 | unc-119(ed4) III; syEx974. | C. elegans | syEx974 [POPFOP + unc-119(+)]. Pick non-Unc and RFP+. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS5647 | unc-119(ed4) III; him-5(e1490) V; syIs202. | C. elegans | syIs202 [vang-1::YFP + myo-2::DsRed + unc-119(+)]; outcrossing suggests array is integrated in LG V. Reference: Green JL, et al. Cell. 2008 Aug 22;134(4):646-56. |
| PS5970 | him-5(e1490) syIs197 V. | C. elegans | syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors. |
| PS6025 | qrIs2. | C. elegans | qrIs2 [sra-9::mCasp1]. Caspase expression in ASK neuron. |
| PS6058 | pha-1(e2123) III; him-5(e1490) V; syEx1147. | C. elegans | syEx1147 [des-2::DES-2::GFP + pha-1(+) + pBluescript KS(+)]. Maintain at 25C to select for presence of transgene. GFP reporter is driven by the promoter of the des-2/des-3 operon and is expressed in ALA, RID, PVD, FLP, IL2, PLM, PVC, and M1 muscles of the pharynx. This construct contains 3.4 kb of sequence upstream of the des-2 start ATG (Treinin et al., 1998) (Van Buskirk and Sternberg, 2010). |
| PS6187 | pha-1(e2123) unc-119(ed4) III; syEx1155. | C. elegans | syEx1155 [myo-3p::tomm-20::mRFP::3xMyc + Cbr-unc-119(+)]. Maintain at 15C. Pick non-Unc to maintain array. |
| PS6192 | syIs243. | C. elegans | syIs243 [myo-3p::TOM20::mRFP + unc-119(+) + pBS Sk+]. Integrated from PS6053. Strain has been outcrossed, but not known if unc-119 mutation is still present in the background. |
| PS632 | unc-101(sy161) I; let-23(sy1) II. | C. elegans | Grows slowly with low brood numbers. Sluggish worms. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS6726 | unc-119(ed4) III; syIs264. | C. elegans | syIs264 [col-183p::mCherry + unc-119(+)]. Dauer decision marker that indicates commitment to dauer formation in the hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7. |
| PS6741 | pha-1(e2123) III; him-5(e1490) V; syEx1341. | C. elegans | syEx1341 [ges-1p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the intestine. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in the intestine. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10. |
| PS6742 | pha-1(e2123) III; him-5(e1490) V; syEx1342. | C. elegans | syEx1342 [myo-2p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + unc-122p::mCherry::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the pharynx. Maintain at 25C and pick animals with red fluorescence in coelomocytes. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in pharyngeal muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10. |
| PS6743 | pha-1(e2123) III; him-5(e1490) V; syEx1343. | C. elegans | syEx1343 [myo-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in body wall muscle. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in body wall muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10. |
| PS6744 | pha-1(e2123) III; him-5(e1490) V; syEx1344. | C. elegans | syEx1344 [rab-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed + pha-1(+) + pBluescript]. GFP expression in neurons. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in neurons. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10. |
| PS6843 | syIs300 V. | C. elegans | syIs300 [15xUAS::(delta)pes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript]. GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS6844 | syIs301 V. | C. elegans | syIs301 [myo-2p:NLS::GAL4SC::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. myo-2 cGAL driver for pharyngeal muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS6872 | syIs302 III. | C. elegans | syIs302 [15xUAS::Δpes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript]. GFP cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS6916 | syIs317 II. | C. elegans | syIs317 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript]. nlp-40 cGAL driver for intestine. NOTE: Incorrectly annotated as being on LG III in paper; actually should be on LG II. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS6934 | syIs319 III. | C. elegans | syIs319 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] III. nlp-40 cGAL driver for the intestine. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS6935 | syIs320 V. | C. elegans | syIs320 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] V. nlp-40 cGAL driver for intestine. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS6936 | syIs321 I. | C. elegans | syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript]. myo-3 cGAL driver for body wall muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS6961 | syIs334 X. | C. elegans | syIs334 [rab-3p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + pBlueScript]. rab-3 cGAL driver for the whole nervous system. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS6963 | syIs336 X. | C. elegans | syIs336 [rab-3p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + pBlueScript]. rab-3 cGAL driver for the whole nervous system. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS6974 | syIs337 III. | C. elegans | syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + pBluescript]. GFP cGAL effector. Weak background fluorescence in some head neurons and the head mesodermal cell. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7044 | syIs341 IV. | C. elegans | syIs341 [15xUAS::Δpes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. channelrhodopsin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7045 | syIs342 II. | C. elegans | syIs342 [15xUAS::Δpes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. channelrhodopsin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7055 | syTi1 X. | C. elegans | syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434). |
| PS7058 | syTi2 II. | C. elegans | syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974). |
| PS7107 | syIs373 I. | C. elegans | syIs373 [15xUAS::Δpes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. Histamine chloride channel cGAL. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7108 | syIs374 V. | C. elegans | syIs374 [15xUAS::(delta)pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. histamine chloride channel cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7127 | unc-119(ed4) III; syIs360. | C. elegans | syIs360 [ets-10p::GFP + unc-119(+)]. Dauer decision marker that indicates commitment to dauer formation in neurons and intestine. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7. |
| PS7136 | syIs378 I. | C. elegans | syIs378 [15xUAS::Δpes-10::mKate2::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. mKate2 cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7149 | syIs390 X. | C. elegans | syIs390 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. GFP cGAL effector. Weak background fluorescence in some head neurons and the head mesodermal cell. [NOTE: (03/18/2020) a user has reported syIs390 does not map to LG X] Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7154 | syIs391 IV. | C. elegans | syIs391 [myo-2p::NLS::GAL4SK::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. myo-2 cGAL driver for pharyngeal muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7155 | syIs392. | C. elegans | syIs392 [unc-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for Cholinergic neurons. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7160 | syIs393 IV. | C. elegans | syIs393 [unc-47p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + pBlueScript]. unc-47 cGAL driver for GABAergic neurons. Relatively weak expression. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7167 | syIs396 syIs337 III. | C. elegans | syIs396 [unc-47p::NLS::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs396 is unc-47 cGAL driver for GABAergic neurons. syIs337 is GFP cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7169 | syIs337 syIs398 III. | C. elegans | syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7171 | syIs337 III; syIs400 V. | C. elegans | syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs400 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)] V. syIs337 is a GFP cGAL effector. syIs400 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7172 | syIs337 syIs401 III. | C. elegans | syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs401 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. syIs337 is a GFP cGAL effector. syIs401 is hsp-16.41 cGAL driver for heat shock promoter. Low levels of GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7185 | syIs406 IV. | C. elegans | syIs406 [15xUAS::Δpes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. GFP::H2B effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7186 | syIs407 V. | C. elegans | syIs407 [15xUAS::Δpes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. GFP::H2B cGAL effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7190 | syIs409 X. | C. elegans | syIs409 [15xUAS::Δpes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript]. mCherry::H2B cGAL effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7192 | syIs413 IV. | C. elegans | syIs413 [15xUAS::Δpes-10::ICE::let-858 3'UTR + unc-122p::GFP + pBlueScript]. Human caspase ICE cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7199 | syIs371 III. | C. elegans | syIs371 [15xUAS::Δpes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. Histamine chloride channel cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7200 | syIs420 IV. | C. elegans | syIs420 [15xUAS::Δpes-10::tetx::let-858 3'UTR + myo-2p::NLS::GFP + pBlueScript]. Tetanus toxin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7201 | syIs421 IV. | C. elegans | syIs421 [15xUAS::Δpes-10::tetx::let-858 3'UTR + myo-2p::NLS::GFP + pBlueScript]. Tetanus toxin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7203 | syIs423 V. | C. elegans | syIs423 [15xUAS::Δpes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. GCaMP6s cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7220 | flp-34(sy810) V. | C. elegans | flp-34(sy810) is a CRISPR/Cas9-engineered 1,365-bp deletion flanked by the sequences TCAAATTTTTTGAGGAAATCCTCCTGAAAC and AATATTTTCGAGTTTCGAAACATTTCAAAT with a AATATATTTTCGAGTTTCGAAACATATTTTCGAGTTTCGAAACAC insertion. Reference: Lee JS, et al. Proc Natl Acad Sci USA. 2017 Dec 12;114(50):E10726-E10735. PMID: 29167374 |
| PS746 | let-23(sy97) II; sli-1(sy143) X. | C. elegans | sy143 suppresses sy97 viability from 15% to 100%, P12 -> P11 transformations from 27% to 14% and Vul from 100% to 3%. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS7521 | syIs483 X; syIs300. | C. elegans | syIs483 [unc-17p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + ceh-19p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] X. Split cGAL driver for MC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS7731 | K03E5.2(sy1082) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG Reference: Wang H, et al. G3 (Bethesda). |
| PS7734 | T05C3.2(sy1080) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAA Right flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7778 | clik-1(sy1084) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda). |
| PS7783 | K03E5.2(sy1086) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7829 | syIs493 I. | C. elegans | syIs493 [sra-9p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASK neurons. |
| PS7833 | Y106G6H.8(sy1076) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of Y106G6H.8 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATCTCCCCACCAAGTGTCGATATGTCTCCAATT; right flanking sequence: ATTCGTCTGGCTGGCCTCTCGGGAGCTGTTGCCATTTC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda). |
| PS7837 | aex-2(sy1078) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATG Right flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7858 | C01B10.10(sy1114) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catcatcagAATATGGACCCGCGTGTATGTCCAATT Right flanking sequence: CAACATGGACCCAGAGCCCTCAAAAATGGGTCGATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCTGGGTCCATGTTGAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7898 | C53C9.2(sy1116 sy1118)/tmC30 [ubc-17(tmIs1243)] X. | C. elegans | Superficially wild-type. a weak allele for C53C9.2 ; 58 bp insertion from downstream sequence of its own and 1 bp deletion (leading to change of an animo acid and insertion of 19 amino acids in frame); balanced with FX30326, further confimed by genotyping for homozygotes of C53C9.2 Left flanking sequence ACCGCTGTCGGTATGCCACGTTGGAATATCACCAAG; Right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATCTG; inserted sequence between the two flanking sequence: CTCGGAGAAGACATTCTCCGACGAGGAACCGAATTCACACCATGGTACTCTGGACAAA. sgRNA : GTATCCTTGCTTCTTGTCCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS79 | dpy-10(e128) let-23(sy1) II. | C. elegans | Dumpy. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS7909 | C56G2.15(sy1120) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C56G2.15. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCGTGAGCATTCACAGAAAAAATCATGCCGTCA; right flanking sequence: GTCCCCTCCAATGTCGTTTTTGTTGCTCAATAAGG; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda). |
| PS7911 | C53C9.2(sy1122)/tmC30[ubc-17(tmIs1243)] X. | C. elegans | Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2. lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG; right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda). |
| PS7921 | unc-119(ed4) III; syEx1539. | C. elegans | syEx1539 [nhr-246p::GFP + unc-119(+)]. Pick non-Unc to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7. |
| PS7922 | C01B10.4(sy1131) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATACACACTTCATTTGGTCATTTGGAAGGTGCAGA Right flanking sequence: GATAGGAGATTATCATTTGTTCAAAAAAATTCCATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATTTGGAAGGTGCAGAGAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7951 | adm-4(sy1161) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of adm-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTGATGACACGTTACATCTAGAGCCATCT Right flanking sequence: TACCCGCATCAACTTTCTGATGATCTTGGGCCTGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GAAAGTTGATGCGGGTAAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7953 | C23H4.2(sy1163) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C23H4.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattgaaacgaagaccatgccatgcagttccagAG Right flanking sequence: TGTTCCGTTTGCAAAGCCACCAATTGGAAATTTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTTTGCAAACGGAACACTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7960 | C04G6.4(sy1165) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C04G6.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGAAGCCACTTTCTTTCGAAATGCCAAAACCGCCA Right flanking sequence: GTTCTCCAGCCAAATATTGCCTCACTTCTACAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATATTTGGCTGGAGAACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7962 | ttc-36(sy1167) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ttc-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGCTCAGTTTGCAGCTCGAGAGAGAAGGTGTCG Right flanking sequence: cCGTTGGCAGAAGGTGTACGGTTGGATGAAGCTATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAGAGAGAAGGTGTCGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7973 | syIs526 III. | C. elegans | syIs526 [flp-24p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALA neurons. |
| PS80 | let-23(sy1) unc-4(e120) II. | C. elegans | Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS8008 | ZC376.2(sy1170) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8010 | cpn-4(sy1172) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of cpn-4 (F49D11.8). Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCAAGCAAGTTCAATGATGTTGAAGCTGGATACT; right flanking sequence: TGTTGGAATGGATTCGGgtaagatttgggtagatt; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda). |
| PS8012 | Y55F3BL.4(sy1174) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55F3BL.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGACGACGGATTCACCCTGGTCACTGGTAGAAA Right flanking sequence: AGCCGGAAAACAGTCGGCGAAATTTgtcagttttc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGTCACTGGTAGAAAAGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8023 | syIs503. | C. elegans | syIs503 [15xUAS::Chrimson::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder (NEB)]. Red light-activated channelrhodopsin cGAL effector. Reference: Cao M, et al. Application of the red-shifted channel rhodopsin Chrimson for the Caenorhabditis elegans cGAL bipartite system. MicroPubl Biol. 2018 Aug 22;2018:10.17912/2JGW-FJ52. doi: 10.17912/2JGW-FJ52. PMID: 32550400. |
| PS8027 | nlp-67(sy1176) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-67; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTCACTTTCTTGCTCGTCACTCTTTTTGCCCTCGC Right flanking sequence: CAATGTCATGCAAGCACAGCGTTACGATCGAGCC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTGCTTGCATGACATTGGCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8029 | R173.3(sy1178) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of R173.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCGAATTGAGGGTCAACTCTGGAGCAATCCG Right flanking sequence: taagtacatgattttttattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTCTTACCAGTCGCTCTCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8031 | cest-1.1(sy1180) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of cest-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGGAGACCTTCGATATCGAAAACCCCGTCCACCG Right flanking sequence: AAATCATGGGAAGGAGTTTTGGTAACAAATGAATA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCTTCCCATGATTTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8033 | F13H6.3(sy1182) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F13H6.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGGGTACCTCGGGATCCCGTATGCGAAACCACCA Right flanking sequence: GTCGGCGAACTTCGATTTAAGAAGCCAGTAACCGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AATCGAAGTTCGCCGACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8083 | syEx1649. | C. elegans | syEx1649 [nhr-246p::GFP + unc-122p::RFP]. Pick RFP+ (coelomocytes) to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7. |
| PS8114 | dod-18(sy1190) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-18; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCATTGAAACAGCTAAAGGAAAATTGACGACTA Right flanking sequence: TTGTGGAAGAAATGAAAAGAAAAGAGgtatagtta inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGGAAAATTGACGACTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8116 | C17H12.4(sy1192) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C17H12.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGGAAAATTAAGATTTCAAAAACCAGAACCGCCT Right flanking sequence: GAGAAATGGACCGGAGTGAGAAATGCAAAAGgtatg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCGGTCCATTTCTCAGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8118 | srx-51(sy1194) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-51; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAACTCATTTGGAATGCTGACTACATCACAGTCTA Right flanking sequence: TTGGGGATGCAGTTATTTCAACAATTTTTGCATTT inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GACTACATCACAGTCTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8120 | gnrr-4(sy1196) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gnrr-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGACTGCATCGTTCTCTTTATCTACGCTCCAACT Right flanking sequence: CAGTTTGCATGGATTCACTCATACTGGgtaagtctg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAATCCATGCAAACTGAGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8124 | syIs528. | C. elegans | syIs528 [15xUAS::kin-2(G310D dominant negative)::let-858 3'UTR + ttx-3p::GFP + 1kb DNA ladder(NEB)] cGAL effector to lower PKA activity. |
| PS8131 | syIs530; syIs300 | C. elegans | syIs530 [ceh-63p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for DVC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8132 | syIs532; syIs300 | C. elegans | syIs532 [hlh-34p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AVH neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8175 | Y55B1BR.1(sy1201) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8177 | npr-23(sy1203) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-23. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGCTTCACCAACTTGATCGCGTTGCTCGTATTGG; right flanking sequence: TGCCGGTGATCATTCATAACGTGTTCACCGGTGTC. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGCGTTGCTCGTATTGGTGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8179 | pals-14(sy1205) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-14; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: TTAAATCCAGTTTAGCAGAGAGAAAAGCGGCAGAG Right flanking sequence: GAGAGGCACAACAAAGCGgtatgatcatgcttacc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAGAAAAGCGGCAGAGGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8181 | pals-16(sy1207) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAATCATTGACAAATTGCAGAACATCAACACCTT Right flanking sequence: Ggtaggttgaagaagttattattggaatttgaaat inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGAACATCAACACCTTGGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8185 | H39E23.3(sy1210) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of H39E23.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGGTCACTGTTCAAGGATTCCCTACAAAAGATC Right flanking sequence: GTGAGGCCAGAGAGACTGAACCAGTGAAACTGCCAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTCCCTACAAAAGATCGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8189 | nlp-76(sy1214) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-76; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagTGTTCATCGCAATCTGCGTGCTCTCCCAAAA Right flanking sequence: CGCTATGGCCCTCCGTGGTGCACTATTCCGTTCTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CACGGAGGGCCATAGCGTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8191 | nlp-77(sy1216) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-77; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACCAGCCGGAGGTCAAGATGTTCCACCATTC Right flanking sequence: CTTCGTAATGCCACTCCAGCTCAACTTCAGAGCTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8201 | oac-2(sy1218) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aattgtggaatttttagATTTCGAAGAATCCTCCC Right flanking sequence: GCTGTACTACTTGACCATCTTCCTCATAGTAGTCATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8203 | affl-2(sy975) Y55B1BR.1(sy1220) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1 into sup-45 mutant (sy975); Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. affl-2 formerly known as sup-45. |
| PS8205 | Y62F5A.10(sy1222) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y62F5A.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGAAGAAGATAACACGGAAGGAGAAATCCAACA Right flanking sequence: CCGCACTGAACAAAACAGCATCCAACGACGATCTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTTTTGTTCAGTGCGGTGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8207 | F44E5.3(sy1224) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F44E5.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTAGAAAGACTATATGCCATAGTAGAAGATCCGCTC. Right flanking sequence: AGTGAGTTCGTTGCAGGCGGACTACGTTgtaagtttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CCTGCAACGAACTCACTGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8219 | Y69A2AR.19(sy1226) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y69A2AR.19; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagAAAAAATCAACGACAATCACCTGGACAGCCCCC Right flanking sequence: GCTCGGATGGACACGAACTAATGGAAAACCCCTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCACCTGGACAGCCCCCGCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8221 | pals-26(sy1228) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-26. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTGCTCAAGACATGCGAAATAACATGCAACCTGAA right flanking sequence: CGTGAGCGCCGGCAAAGGGAGCTTGAAGCTTTAG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTTGCCGGCGCTCACGTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8223 | Y39C12A.9(sy1230) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y39C12A.9; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCATATATGAATTCAATGGCAAAAGTAGACCCGAA Right flanking sequence: TGATCCATACGTGTTTAAAAAGGATTTAGgtacgtg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAAACACGTATGGATCATTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8225 | F52G2.3(sy1232) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F52G2.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCAAATTGACGGTGTCTGCTTCATAAGTCCTGAG Right flanking sequence: TGCGGAACCATAGTTATCGAACCGCCGGCTCCGG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATAACTATGGTTCCGCACTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8234 | srw-54(sy1234) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-54; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: TTTGGTACGATCTGCAAAACATCATCAGGCCTATT Right flanking sequence: GATGTGTACTTGGATTACTTCAACTTTTCAATATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAATCCAAGTACACATCAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8240 | srw-43(sy1240) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-43; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cactttccaatatttcagCATACCTCCCCTGTCCT Right flanking sequence: ATCTGGAAATGTATTTTATCCAATTATTCAATTCC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATACCTCCCCTGTCCTATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8250 | oac-24(sy1246) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-24; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaaaatttcagATTCTTTGTCATTTCCGGATACC Right flanking sequence: TCATGGCGAAAAATTTAACGAAGACTAAACTTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTCATTTCCGGATACCTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8252 | srw-36(sy1248) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGACTGTTAACCAATTTCTGATAGGTATCGTAGT Right flanking sequence: TTGTGGGATTATCCACAATGTATGTAGTATCATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGATAGGTATCGTAGTTTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8263 | srz-103(sy1254) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srz-103; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGATTAATTGTAGCGTATATTCTCATATGTCGTA Right flanking sequence: ATCTGGATGTTCTTCAAAGATTGCCAATTGTATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TATTCTCATATGTCGTAATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8265 | oac-38(sy1256) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-38; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTAGGATTTCACTTCCTGCCAGATGTATTTCC Right flanking sequence: TAATGGATACTTAGGAGTTGATCAgtaagttttcaac inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGCCAGATGTATTTCCTAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8278 | syIs536. | C. elegans | syIs536 [15xUAS::lin-3c::SL2::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] cGAL effector for epidermal growth factor |
| PS8279 | syIs537; syIs300 | C. elegans | syIs537 [glr-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8282 | syIs554; syIs300 | C. elegans | syIs554 [nmr-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + flp-20p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for PVC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8284 | syIs556. | C. elegans | syIs556 [15xUAS::GtACR2::SL2::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Natural light-gated anion channel cGAL effector, inhibited with blue light. |
| PS8288 | syIs559; syIs300 | C. elegans | syIs559 [flp-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AVK neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8290 | syIs561. | C. elegans | syIs561 [ttx-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AIY neurons. |
| PS8293 | syIs564. | C. elegans | syIs564 [odr-10p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWA neurons. |
| PS8301 | oac-40(sy1258) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-40; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTACCAAATTTCTTATGGGAAACTAATAACCGGTA Right flanking sequence: TTCGTTGGCTTCATTATTTTTAGTCACAAATCAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATAATGAAGCCAACGAATAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8303 | oac-59(sy1260) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-59; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCACCGTCTTCAAAACGGCTGGACCTTCAAGGCAT. Right flanking sequence: TAGAGGGTTGGCAATTCTATCAGTTCTGGGATTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGACCTTCAAGGCATTAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8305 | nlp-78(sy1262) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-78; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGCTTTCTCAAACATCTGTAGTGCGTATCCAGAT Right flanking sequence: TATCGACTTCCTGAAAGAgtaagttttgagaatttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTTCAGGAAGTCGATAATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8307 | nlp-80(sy1264) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-80; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCTCTTGTGTATTCTGTTTGCTTTATCCGAAG Right flanking sequence: CTTACAGTCGCATGGAGTTGGAgtaagttaagaac inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCATGCGACTGTAAGCTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8311 | nlp-82(sy1266) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-82; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cattttccaactataaattttacagATGCCGTCA Right flanking sequence: TACCACACTGTAATCATCATCCTGCTCATCTCAAT inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATGATTACAGTGTGGTATGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8313 | nlp-79(sy1268) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-79; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaattaaattcaacttttcaggtaaaATGTCCACT Right flanking sequence: CGGTGGTTTGTGTTCGTCGCCCTGATGGCTCTCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGGTAAAATGTCCACTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8315 | npr-29(sy1270) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-29. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaATGGACTTTACGGAAAATGAAGAGGAGTACGAG right flanking sequence: CATTGGACACATATTGAACGACGAGTCCCGTTTC Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGAAGAGGAGTACGAGCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8317 | npr-33(sy1272) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-33. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAACGAGCACATTGATAAGTGTACTGGCCACCC right flanking sequence: AATCAGCTCCGCTTCAATGCTTTTCCTGTCATCCG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGAAGCGGAGCTGATTGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8330 | frpr-5(sy1274) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-5. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: gATGAAAATGCAGATCTCCTCGCGTACACCAAAA right flanking sequence: CGTTGGCTTGCCGAGGTGAACATTGTAGATGTTG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCTCGGCAAGCCAACGTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8334 | frpr-11(sy1278) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-11. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAACTGCTTCCTCATCTTTAAACTCACACAGTTATG right flanking sequence: ATATGGTTGAAGTGTTTGCTATGATTATGTTGCC Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACTCACACAGTTATGATA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8365 | oac-8(sy1284) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTCGCGTTTCACTTTTTCCCTAAAACCTTCCCAAAT Right flanking sequence: GGGTATATTGGAGTAGATATgtaggttgaaataaa inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCTACTCCAATATACCCATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8367 | oac-22(sy1286) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-22; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACGCGTTACTTTTTGTGTCAAACAGACCAAAAA Right flanking sequence: CTGTGGCAGAGGACTATTTTACAATGgtaggtgctg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTCAAACAGACCAAAAACTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8369 | oac-34(sy1288) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-34; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gCTTCTTTGTGATCTCCGGTTACCTGATGGCCCGTA. Right flanking sequence: ACCTGACACACATGAAAATCTCCAAAATCAGTGAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTTCATGTGTGTCAGGTTAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8373 | syIs595. | C. elegans | syIs595 [mec-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALM, AVM, PLM, and PVM neurons. |
| PS8394 | oac-52(sy1290) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-52; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCAAGGTATTCGAGGTCTTGCTATTACAGTTGT Right flanking sequence: ACTAGGTTTTCATTTCTATCCAGAAGCTTTTCCC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTGCTATTACAGTTGTACT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8396 | frpr-1(sy1292) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAAACAAGGCAGGTTGTCAAGGAATACGAACAGTTCA right flanking sequence: ATCTGgtgagttaaaacttcaatttagtgctatg Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAATACGAACAGTTCAATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8398 | frpr-9(sy1294) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-9. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCCATCAGTATTCAATGATATTCAGGCAACCATTC right flanking sequence: GATTATTCGGAGgtattataaaattctgtttattt inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATACCTCCGAATAATCGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8400 | frpr-7(sy1296) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-7. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTCGCCGTCGACCACCTTCATTGCCTTCATCTTT right flanking sequence: GACTGGGCCCTATACTTCATCCAAATGTTGTCGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCATTGCCTTCATCTTTGAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8407 | syIs567. | C. elegans | syIs567 [15xUAS::destabilized-YFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] YFP cGAL effector. |
| PS8408 | syIs568. | C. elegans | syIs568 [15xUAS::tra-2(ic)::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] cGAL effector to induce feminization |
| PS8409 | syIs569; syIs300 | C. elegans | syIs569 [nmr-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + flp-7p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for AVG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8412 | syIs572. | C. elegans | syIs572 [15xUAS::TeTx::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] Neurotoxin cGAL effector. |
| PS8416 | syIs580; syIs300 | C. elegans | syIs580 [nlp-12p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for DVA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8419 | syIs583 III. | C. elegans | syIs583 [15xUAS::GCaMP7s::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] III. In vivo calcium indicator cGAL effector. |
| PS8423 | syIs587. | C. elegans | syIs587 [15xUAS::GCaMP7f::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. In vivo calcium indicator cGAL effector. |
| PS8426 | frpr-13(sy1298) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-13. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: aaaaaatgatgacgctttgatttcagACACCCTTC right flanking sequence: GCAAGAACAGGACAATTCTACGAAAATCGCTCGAT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTGTCCTGTTCTTGCGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8428 | frpr-14(sy1300) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-14. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGATATTTTGCAATTCCTGTTTGGGATCCACAG right flanking sequence: ATCCAGAATATTTGgtgagtttaggcttaggcttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACCAAATATTCTGGATCTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8430 | frpr-17(sy1302) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-17. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCAGTTAATCAGTCATGATATTATCGATCCAAGCT right flanking sequence: CAGTGGGATTTCAAAACTGTGAACCTTTGgtgag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTATCGATCCAAGCTCAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8432 | frpr-19(sy1304) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-19. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATGATTGGCTCAACAGAGGTGCCGTTGTTTGAGG right flanking sequence: AGGAGGATATGTGTACACCACTCAACATTTCTTGTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTGCCGTTGTTTGAGGAGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8437 | syIs599. | C. elegans | syIs599 [nhr-246p::GFP + unc-122p::RFP]. Pick RFP+ (coelomocytes) to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7. |
| PS8438 | syIs600. | C. elegans | syIs600 [col-183p::mCherry + odr-1p::GFP]. Dauer decision marker that indicates commitment to dauer formation in the hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7. |
| PS8441 | daf-2 (e1370) III; glo-1(sy1306) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8442 | npr-26(sy1307) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-26. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGCCCGATGGGATTTTGTATTGTCCAAATCACAC right flanking sequence: TGGTGGTCCCGTCTGGGTACGCAATGTCTATCCAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTGTCCAAATCACACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8444 | npr-21(sy1309) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTGTATCCTACCTTTTTGTCTTTCTGGCCACTAT right flanking sequence: AATCGgtatgccaaggatctttgttcatattttta inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCTTTCTGGCCACTATAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8450 | npr-27(sy1315) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-27. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gggtgtgccttcttgATGGAGGATTTTTCCTCGA right flanking sequence: ATTTCACGACAACTTCAATTCAGAATGATAGTTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAAGTTGTCGTGAAATTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8453 | syIs534; syIs300 | C. elegans | syIs534 [flp-20p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + inx-11p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for gland cell. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8457 | syIs601. | C. elegans | syIs601 [ets-10p::GFP + ofm-1p::RFP]. Dauer decision marker that indicates commitment to dauer formation in neurons and intestine. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7. |
| PS8459 | syIs589. | C. elegans | syIs589 [15xUAS::wrmScarlet::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] mScarlet cGAL effector. |
| PS8461 | syIs591; syIs300. | C. elegans | syIs591 [srh-142p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADF neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8462 | syIs592; syIs300. | C. elegans | syIs592 [srh-200p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADL neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8463 | syIs593. | C. elegans | syIs593 [15xUAS::rlp-22HA::SL2::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Tissue specific RNA-seq cGAL effector. |
| PS8466 | syIs605. | C. elegans | syIs605 [15xUAS::iC1-C2-TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Chloride-conducting channelrhodopsin cGAL effector. |
| PS8470 | syIs609. | C. elegans | syIs609 [15xUAS::nCRE::SL2::GFp::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Nucleolus-transport-enhanced Cre protein cGAL effector. |
| PS8476 | syIs615. | C. elegans | syIs615 [15xUAS::lmp-1::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Lysosomal associated membrane protein cGAL effector. |
| PS8484 | npr-31(sy1360) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-31. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaaaaactagttataaaaatgttcagATCCCTTA right flanking sequence: TGTCCAGAAGCTCCCCTTCAGATCGATTACGTGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGGGGAGCTTCTGGACATAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8486 | frpr-8(sy1362) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTATTTCGCTTCTTAATAATTCTACACTGGTCA right flanking sequence: CTACGGATCAGCCAGGTTTTTCTGGAAGTACAAAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAATTCTACACTGGTCACTA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8488 | frpr-2(sy1364) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTATGCGTGAGTGTGAATGCCTTCATGAGCCGATA right flanking sequence: GAGGGGTACGCGGGAGTTGCCAATCTGgtaagtatac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTCCCGCGTACCCCTCTAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8490 | frpr-16(sy1366) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-16. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cacattATGAATCGGTACGAGTTCTACGAGCTAAAA right flanking sequence: TCATGGATGTATTTACCTGTAATTTTCATTGGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGTTCTACGAGCTAAAATCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8496 | syIs627; syIs300. | C. elegans | syIs627 [str-2p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8498 | syIs629. | C. elegans | syIs629 [15xUAS::ChR2(C128s)::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Stable step function ChR2 variant cGAL effector. |
| PS8501 | syIs632. | C. elegans | syIs632 [15xUAS::myri::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Cell membrane labeling fluorophore cGAL effector. |
| PS8504 | syIs635. | C. elegans | syIs635 [15xUAS::hChR2(C128s, D156A)::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Stabilized step function Opsins ChR2 variant cGAL effector. |
| PS8505 | syIs636. | C. elegans | syIs636 [15xUAS::miniSOG-103L::VAMP2::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Reactive oxygen species production cGAL effector. |
| PS8508 | syIs639. | C. elegans | syIs639 [15xUAS::SwiChR::TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Step-Waveform Inhibitory Channelrhodopsin cGAL effector. |
| PS8509 | syIs640. | C. elegans | syIs640 [15xUAS::fem-3::mCherry::let-858 3'UTR + ttx-3p:RFP + 1kb DNA ladder (NEB)] cGAL effector to induce masculinization |
| PS8527 | oac-56(sy1372) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-56; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTTTACTATTTCACTTGAACCCTAACCTATT Right flanking sequence: TGTTAATGGATTTCTCGGTGTTGATATgtaagccc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctag. sgRNA : CGAGAAATCCATTAACAAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8529 | oac-57(sy1374) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-57; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGATATCATTTGCATTCAATTTTATTCTTCCATCT Right flanking sequence: AAAGTCTCTTTTAACAGTTTGCTTGCAAGAATATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTTAAAAGAGACTTTAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8531 | oac-58(sy1376) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-58. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGATCTCATTCACATTCTATTCAATTCTCCCACT right flanking sequence: TGAAGTGGCTTTTAACAGTTTATTTGCAAGAATATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTAAAAGCCACTTCAAGT Method Reference: G3 (Bethesda). |
| PS8536 | oac-51(sy1388) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatttaataatttaggcATGGTAGTTTACACCGCT right flanking sequence: CTGTGGAACATTGAAGATCAAAATAAGCAATTTAAAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGTAGTTTACACCGCTCTG Method Reference: G3 (Bethesda). |
| PS8538 | oac-35(sy1390) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-35. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTTCTAATGTGCATGTTGCTCAAGCGTGCCGAGA right flanking sequence: CCCACCCATTTTTCACGTTGTTATGCACATTTTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGTGAAAAATGGGTGGGTCT Method Reference: G3 (Bethesda). |
| PS8540 | dod-17(sy1392) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-17. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTAATTGATGGTACGCCTGTATATTGGCCAGCT right flanking sequence: GCTTGGAACGAGACTCAGCCTGCTCCTCAGCTGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAGTCTCGTTCCAAGCAGC Method Reference: G3 (Bethesda). |
| PS8542 | acs-10(sy1394) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of acs-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTCTGGACTCATGTCGTATCCATGCAGCCGCCA right flanking sequence: ATAAGGACGCCATAGTTTTTgtgagtacggatttatc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTATGGCGTCCTTATTGG Method Reference: G3 (Bethesda). |
| PS8544 | clec-87(sy1396) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-87. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTTTTGCCTTCTCGTTGCTTTCATCCTTCCTGGG right flanking sequence: CTATTCCTCGTTCATGCAGCTCCGACTTCTTCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCATGAACGAGGAATAGCCC Method Reference: G3 (Bethesda). |
| PS8553 | syIs654. | C. elegans | syIs654 [15xUAS:VSFP-Butterfly-1-2::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Voltage-sensitive fluorescent protein cGAL effector. |
| PS8556 | syIs657. | C. elegans | syIs657 [15xUAS::act-2::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. cGAL effector for localiziation of actin filament and cell cortex |
| PS8558 | syIs695. | C. elegans | syIs659 [15xUAS::miniSOG-103L::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Reactive oxygen species production cGAL effector. |
| PS8562 | syIs663; syIs300. | C. elegans | syIs663 [gcy-33p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for BAG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8565 | syIs666; syIs300. | C. elegans | syIs666 [str-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWB neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8578 | clec-88(sy1409) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: TTGGTATGTGCAGTTACTAACGATATTGAAGACGC right flanking sequence: TAGTGGAGAGACACCTGGAATTGTTTCTCAAATTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGATATTGAAGACGCTAG Method Reference: G3 (Bethesda). |
| PS8580 | oac-36(sy1411) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-36. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATGTGCATGTTGCTCAAGCGTGCCGAGACCAAGC right flanking sequence: CATTTTTCACAGTGGTATGCACATTTTACACGAGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCACTGTGAAAAATGGCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8582 | oac-41(sy1413) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-41. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATTTTAATATTAGTACACGTTTTTCTACCGGAT right flanking sequence: TTCCTGTGGCAAAATAATAATAGATACTCTTTCGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTATTTTGCCACAGGAAATC Method Reference: G3 (Bethesda). |
| PS8584 | clec-91(sy1415) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-91. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGACCTACATCCTTATCATCGTCCCACTGATCAT right flanking sequence: CATTGGAGGCGGTGTCGTCGCTGACAACACAAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCGTCCCACTGATCATCAT Method Reference: G3 (Bethesda). |
| PS8586 | npr-9(sy1417) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-9. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCATCATTGCCTCTTCAGTAAATACACGTTCACC right flanking sequence: CATAGgtgtataattgaacttatgtatatgttttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAAATACACGTTCACCCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8630 | oac-44(sy1431) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTCGGATTCCACTTCTACCCAAACCAGTTTCC right flanking sequence: CAATGGATACCTCGGAGTGGATCAgttaggtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCCAAACCAGTTTCCCAA Method Reference: G3 (Bethesda). |
| PS8632 | oac-42(sy1433) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-42. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTGACTTACAAGGAATTCGGGGTCTCGCCATTG right flanking sequence: CTGCAGTGCTTCTTTATCACTTTTATCCAAAACAA inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATAAAGAAGCACTGCAGCAA Method Reference: G3 (Bethesda). |
| PS8634 | col-135(sy1435) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-135. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCAGCGCTCGGGTATAATATTCGATATCCCTCCT right flanking sequence: ATGAACCAAATCGACAATATGGCCCATATTCGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTCGATTTGGTTCATAGG Method Reference: G3 (Bethesda). |
| PS8636 | ins-10(sy1437) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAAAAACAATTCTTCTAATCTCATTCTTGCTCCTCGT right flanking sequence: AACATTGGCTCCCAGAACAAGTGCAGCTTTTCCATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGGGAGCCAATGTTACG Method Reference: G3 (Bethesda). |
| PS8642 | syIs672; syIs300. | C. elegans | syIs672 [gcy-8p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AFD neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8643 | syIs673; syIs300. | C. elegans | syIs673 [rig-5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for SAA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8648 | syIs678; syIs300. | C. elegans | syIs678 [flp-8p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for URX neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8650 | syIs680; syIs300. | C. elegans | syIs680 [gcy-5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASEL neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8653 | syIs683; syIs300. | C. elegans | syIs683 [gcy-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASE neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8660 | syIs690; syIs300 | C. elegans | syIs690 [tph-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR +pdf-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. [NOTE: Pick animals with RFP+ coelomocytes to maintain. Array appears to be lost or silenced in some animals.] Split cGAL driver for NSM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8661 | syIs691; syIs300. | C. elegans | syIs691 [pdf-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + grl-2p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for MCM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8674 | nlp-6(sy1449) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCGACTCGCCTTCGTTCTTCTCGTCTCGGCGTGCG right flanking sequence: TCATGGCAATGGCTGCTCCAAAACAAATGGTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCTCGTCTCGGCGTGCGTCA Method Reference: G3 (Bethesda). |
| PS8676 | nlp-9(sy1451) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-9. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gaaaaaaagagagATGGATCGATTCGCCACCAGAT right flanking sequence: TTATCGCCCTTCTTCTGGTTCTTTTACAAATTGgtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGAAGAAGGGCGATAAATC Method Reference: G3 (Bethesda). |
| PS8678 | nlp-13(sy1453) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGATCTCTTCAGATCTTCTGCATCATGTCCGCCA right flanking sequence: TCGCAATGGCATACAGTCAAGgtttgtgttgtgtc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTGTATGCCATTGCGATGG Method Reference: G3 (Bethesda). |
| PS8680 | nlp-16(sy1455) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-16. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTTTCCCCATTGGAAAAGACAATGAATCCGACG right flanking sequence: AGTCCGAAGTTGAAGTGGATACCACAACTGAAGCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTTCAACTTCGGACTCGT Method Reference: G3 (Bethesda). |
| PS8682 | nlp-19(sy1457) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ctctactgttgtatattcttcttcacaATGCTCTT right flanking sequence: ACGCGGTGTATGCCTTGCTCTTCTCATTCTAGTCAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTTCACAATGCTCTTACG Method Reference: G3 (Bethesda). |
| PS8687 | nlp-32(sy1459) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-32. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTACTTGTATTCTGTCTTATCGCATTGACCGCCT right flanking sequence: TGCCGGTTTTCTCTTTTCCAAATGGGCTAACTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGAGAAAACCGGCAAGG Method Reference: G3 (Bethesda). |
| PS8689 | nlp-33(sy1461) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-33. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTCTCTTTGCCATATTGGCTATCGTTGATGCCCA right flanking sequence: GTGGGGATgtaagttttcaataacttgtttctg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCTATCGTTGATGCCCAGTG Method Reference: G3 (Bethesda). |
| PS8691 | nlp-43(sy1463) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gctcggaagtATGTCGTTGGCTCAATCTACCTTCT right flanking sequence: ACCTTCTATTTGTTGCATTTTTGGCAGTTGTGATC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACAAATAGAAGGTAGA Method Reference: G3 (Bethesda). |
| PS8693 | nlp-73(sy1465) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-73. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGCTCATCGCGACCACTGTGCTCATCGCCGAGT right flanking sequence: CTCGTGTATTCTATAACCGATTCGACGGCGGGCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATAGAATACACGAGACT Method Reference: G3 (Bethesda). |
| PS8695 | lgc-16(sy1467) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCACATTATTTTCATTTTCTGACATTTCCGCAT Right flanking sequence: TTTATCATGATCCAGGATTATATGgtaaagtttgg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCTGGATCATGATAAAATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8697 | lgc-18(sy1469) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-18. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gtttttattcaaaatgttaattcttcattttgcagTTCCG right flanking sequence: GAATGGAACAATTTCTTGGAGAATCAAGTTAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCATTTTGCAGTTCCGGAA Method Reference: G3 (Bethesda). |
| PS8702 | lgc-19(sy1472) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCGATTCTTTTTTCTTTGATCCAGAGTTATAC right flanking sequence: Ggtaggctattttggctttcaggctcaaaaaaggtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGATCCAGAGTTATACGGT Method Reference: G3 (Bethesda). |
| PS8704 | lgc-1(sy1474) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagTGGCAACCTACAACAAATTTCTCGCCGATCAA right flanking sequence: AAACGGCTTTGGGATGATTTATTCAAAGATTATGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTTCTCGCCGATCAAAAA Method Reference: G3 (Bethesda). |
| PS8705 | lgc-24(sy1475) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-24. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGTCACAATGGGAAACGGGAAAAAGCTTCACGG right flanking sequence: TTTTGgtgagttttatttttcatatgttgattattag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGGAAAAAGCTTCACGGTTT Method Reference: G3 (Bethesda). |
| PS8707 | lgc-21(sy1477) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-21. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGCATTTGCTCTAGGCCAAGAGCAGAACCAAGC right flanking sequence: CGGTACCGCGGTTGCCGGGCCCCATATCGTCAACTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGGCAACCGCGGTACCGGCT Method Reference: G3 (Bethesda). |
| PS8708 | lgc-22(sy1478) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-22. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCTTCTCATTGCCACGTCACTGGCCGCCACGTTA right flanking sequence: GCGTGGGCGGCGGGCACCGCCGGCGGCTGCGAGGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTGGCCGCCACGTTAGCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8710 | lgc-25(sy1480) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-25. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cggtttcaagGGATTCTGGTAATCTGGCACCTGGA right flanking sequence: TAATCAAGTGTGTGGTCTTTCAAAAGAGCAACAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACCACACACTTGATTATCC Method Reference: G3 (Bethesda). |
| PS8711 | lgc-29(sy1481) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-29. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATATATTCGCTTTTATTTTATTTAATGGTCCCTCTC right flanking sequence: TGGAGCACTGATTCACAGAGCATGACGTCAGAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGAATCAGTGCTCCAGAG Method Reference: G3 (Bethesda). |
| PS8713 | lgc-32(sy1483) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-32. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTGCACAAGTGATGAAGATGTGATTGCTGATCT right flanking sequence: CTTAGGAAGAAATTCACATTCTTCTGgtaacttattg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GATGTGATTGCTGATCTCTT Method Reference: G3 (Bethesda). |
| PS8721 | lgc-30(sy1486) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-30. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTCATCCCGAAAAAACTAATAAAAAAGCCGCCG right flanking sequence: GCTATCGACGACACGGCGTTTCATCGGCGTCGAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCGTGTCGTCGATAGCCGG Method Reference: G3 (Bethesda). |
| PS8723 | lgc-27(sy1488) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-27. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACACTTTCAGTTGCCGCTTATGATATCGATTGC right flanking sequence: AAATGGAAAAGCAATATTACAGgttggtgctcaaac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTATGATATCGATTGCAAA Method Reference: G3 (Bethesda). |
| PS8725 | lgc-28(sy1490) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-28. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGCTTAAATATTCAACTGGAACCTTCTCCTGGCG right flanking sequence: AGATGGAGAAAAGATATGAAGCTGAGgtatgtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAACCTTCTCCTGGCGAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8727 | lgc-37(sy1492) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-37. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATAATTCCCATCATTGCTCTAATCCATGGACATCATT right flanking sequence: CTCAGGCTGTCATAGACATGAAGAGACAACGgtaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATCCATGGACATCATTCTC Method Reference: G3 (Bethesda). |
| PS8729 | lgc-41(sy1494) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-41. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCGGCCACCAACAGCAAATGCATCAGTACCACTC right flanking sequence: GGTGTCAAACTTGGAATGTATTTGGAGAGTCTCGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCCAAGTTTGACACCGAG Method Reference: G3 (Bethesda). |
| PS8731 | lgc-43(sy1496) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cttctaattttcagAAGTTTTAACAACCGAAG right flanking sequence: CGTCAACTGATTCTTCTTCTCCAACATCGAGCATATTTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGAAGAATCAGTTGACGCTT Method Reference: G3 (Bethesda). |
| PS8741 | lgc-44(sy1500) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTATTTCTCTTCTTTTTCTAATATTTCCACAT right flanking sequence: TCATCTAATCCTTCAAGCTCTAATTTTCTGGATATTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTGAAGGATTAGATGAATG Method Reference: G3 (Bethesda). |
| PS8742 | lgc-47(sy1501) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-47. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCCACATTGTTTCTGTTGCTCTATGCCACCCGGG right flanking sequence: AAACGGTCAATGCAATGACTGCCGAGATCAGCCC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATTGCATTGACCGTTTCCC Method Reference: G3 (Bethesda). |
| PS8743 | lgc-36(sy1502) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-36. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGGAAGTTTTCGTATAAAACGAACTGTTCACCCT right flanking sequence: AAAAGgtaagtaaccatctaattcaactattttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGAACTGTTCACCCTAAA Method Reference: G3 (Bethesda). |
| PS8745 | lgc-7(sy1504) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-7. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTCTTATTATCAATATTTCAATGAATACCATGT right flanking sequence: CTGTTCTAACACTAGATCCTGCTGAAGAAACCATC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCTAGTGTTAGAACAGACA Method Reference: G3 (Bethesda). |
| PS8747 | lgc-48(sy1506) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-48. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagcttcATGTTTTTTCATATTTTTTTGGGCCTACT right flanking sequence: GGTCGCTGTTTTGGGTGAAGAAGTTCATGAACTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACCCAAAACAGCGACCAGT Method Reference: G3 (Bethesda). |
| PS8749 | lgc-8(sy1508) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGTATCAGAGCAGTTGAAGGATGTTCTTATGGAA right flanking sequence: Ggttggtattgatttagttcaccaaaaagagtttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGGATGTTCTTATGGAAGGT Method Reference: G3 (Bethesda). |
| PS8751 | otpl-1(sy1510) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCACTGTTCTTAACCATTTTCTCACTGGTACTCG right flanking sequence: AGCTGGCTCACTTGCTCAATGATGAGGAATCCCGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTCACTGGTACTCGAGC Method Reference: G3 (Bethesda). |
| PS8769 | syIs695. | C. elegans | syIs695 [trx-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. |
| PS8779 | col-88(sy1512) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCCTTATCGGTACCCAGGTGATCCTCTCCACCG right flanking sequence: CTATCCTTGGCTCCCTGCTCTACGCCGGTGTCCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGGGAGCCAAGGATAGCGG Method Reference: G3 (Bethesda). |
| PS8785 | ZK637.2(sy1518) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZK637.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGATGAGATGATTGACGATTTGGATAAGACCTATT right flanking sequence: TGAGGGATATGCAGAAGAGCATGTTTCAGTGCTCAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTCTGCATATCCCTCAAAT Method Reference: G3 (Bethesda). |
| PS8787 | col-81(sy1520) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-81. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaatatccctctcaattccagCATCGCCGCCGCTC right flanking sequence: TCATCGCTGTCATCGCCATCCCAGCCTTCTACAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGCGATGACAGCGATGAGAG Method Reference: G3 (Bethesda). |
| PS8789 | dmsr-1(sy1522) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTATACATGCCTACTTATCAATATTTCTATGCGT right flanking sequence: GTTGGGTACAATCGCTAATTTCTGTAACATCGTCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCAATATTTCTATGCGTGTT Method Reference: G3 (Bethesda). |
| PS8819 | col-120(sy1526) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-120. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTCTGGAATCATGTGCATTATTCTAATTCCTGGG right flanking sequence: CTTTACACATATCTACAATATATTCAAAGCTCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTAGATATGTGTAAAGCCC Method Reference: G3 (Bethesda). |
| PS8821 | col-129(sy1528) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-129. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ccgtctggcaccaaatgATGACTGTTGTCCCACA right flanking sequence: AGGAGGCAAGCAACGTCAAGTCTACGAGTCCCTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGACTGTTGTCCCACAAGG Method Reference: G3 (Bethesda). |
| PS8822 | col-137(sy1529) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-137. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATCGCAATTTCCACGATTGCAACTCTGACCGCTA right flanking sequence: TCTTGGCAATTCCAATGTTGTACAATTACATGCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACTCTGACCGCTATCT Method Reference: G3 (Bethesda). |
| PS8823 | dmsr-6(sy1530) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaatacttactaatttaaaatttttagCCTATA right flanking sequence: CTCTAACGTTCATCCTTTCTTGTCATTCATCCTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGGATGAACGTTAGAGTAT Method Reference: G3 (Bethesda). |
| PS8825 | clec-47(sy1532) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-47. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCATTTTTGTACTTGCAATTTTTATATTTCCAATT right flanking sequence: GCTTCAATTTCGTGTCCAAGTGGCTTTACACTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGACACGAAATTGAAGCAAT Method Reference: G3 (Bethesda). |
| PS8827 | col-139(sy1534) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-139; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTTACCGATTCATTGCCTACTCGGCAGTTACAC Right flanking sequence: TTTCGGTTGCTGCAGTTTTTGGGgtaagtttcagc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTACTCGGCAGTTACACTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8829 | col-156(sy1536) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-156; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGAACACGTTCATCGCTGGACTCACCACTGT Right flanking sequence: ATCCGGTGTAGCGATTCTCGGATGTCTTTTGTTTTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTGGACTCACCACTGTATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8834 | syIs696; syIs300. | C. elegans | syIs696 [nlp-56p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RMG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8839 | syIs700; syIs300 | C. elegans | syIs700 [nlp-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for PVQ neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8843 | syIs704; syIs300. | C. elegans | syIs704 [pdf-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + mbr-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for AIM neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8844 | syIs705; syIs300. | C. elegans | syIs705 [gcy-32p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AQR, PQR, and URX neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8846 | syIs707; syIs300. | C. elegans | syIs707 [osm-10p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, srb-6p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for PHA and PHB neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8849 | syIs710; syIs300. | C. elegans | syIs710 [srg-13p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8854 | dmsr-7(sy1539) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-7; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTCAGTTGTTTGATCCGAACAGTAACAGTA Right flanking sequence: CGCAGGCATTTCTTCGGAAACTTGCACATTTTCAAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGAACAGTAACAGTACGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8856 | dmsr-8(sy1541) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATATTCATCCGTACGTCTCTGTGATTCTCTGTCT Right flanking sequence: TGCAGgttggttattatgaagtgatcgcacatgttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCTGTGATTCTCTGTCTTGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8858 | dmsr-3(sy1543) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACGGTATTCGAGACGTTTCTCCTCGAATAT Right flanking sequence: GGGAGGATAATTCACCCGCCGATGGTCCTACTTTTATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGTTTCTCCTCGAATATGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8860 | dmsr-4(sy1545) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGGAACACTGTTCGACCCGCAGGATCCCGCAG Right flanking sequence: TTTCTGGCCTCATCGATGCTCTCGAGCAATTTCAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATCGATGAGGCCAGAAACTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8861 | dmsr-9(sy1546) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-9; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATATTTTAGCCAATATCCGGAAGCCAATAGTG Right flanking sequence: ACGAGGCAAAAGATTTGTTTATTACTTCATTGATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGGAAGCCAATAGTGACG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8863 | dmsr-10(sy1548) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCAGTGGCCAGATCCAGAAACTGGAGATGCTAAGG Right flanking sequence: ACTTGGTTATTTCTCAATTTATTAATACAGTTGTAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AACTGGAGATGCTAAGGACT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8865 | lgc-42(sy1550) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-42; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAATGGAAATCCGAAGGCTCCGCTGCAAGTGCA Right flanking sequence: CTTTGGTTTTTATGTGGAGAGCTTGGGAAATTTCAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCCGCTGCAAGTGCACTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8872 | syIs716; syIs300. | C. elegans | syIs716 [klp-6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for IL2 neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8882 | dmsr-11(sy1551) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-11; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTGAGGCTGCAATTAATAACGGAATTGTTTCCTTCA Right flanking sequence: TGGACGCATTAGTAAAgtaatttaaactttagc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTTACTAATGCGTCCATGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8884 | dmsr-14(sy1553) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-14; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGTTTATTGCTGTTAGTGATTTCGGATGTGCAGT Right flanking sequence: TACTGGTTTGATGCAATTATTTATAAGAAATTATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GATTTCGGATGTGCAGTTAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8886 | gnrr-1(sy1555) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gnrr-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCAATGATTCTGTTCTATCAATTGTCTTCACAT Right flanking sequence: ATTTGGCTTTATTTATTCTGGCATTTGTTGGAAATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATCAATTGTCTTCACATATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8888 | dmsr-5(sy1557) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttgaaaaaaatggttgcagGGTCTACACAGTATTG Right flanking sequence: CATCGGTATTTATGTCTTTTTGTGTGTTTTTTCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGGTCTACACAGTATTGCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8890 | dmsr-12(sy1559) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-12; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGCCGTTTCACTACTATATATTCACTTCCTTAG Right flanking sequence: TTGTTTTGCATTTTTTGCAAATATTATGATTGTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAAAAAATGCAAAACAACTA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8892 | dmsr-13(sy1561) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-13; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACTGTGCCATATCCGGAGCCGGGCACCGATGAA Right flanking sequence: GTTGGGAATAGCACGATTCCATGGTTGATTACTAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGCCGGGCACCGATGAAGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8894 | dmsr-15(sy1563) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-15; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: AAAAAACATGTCAGAAAATAAAAATCGCGGAGATA Right flanking sequence: TTTCGGATTGTCAACAAAATTTGCTCGATTCAAATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAAAAATCGCGGAGATATTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8896 | dmsr-16(sy1565) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTAAGTTTCTTTGCAAATGCTCTTATCGCTATAG Right flanking sequence: TTCTGGCAAACAAGGTTATGAGGATTTCTGGAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGCTCTTATCGCTATAGTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8897 | oac-21(sy1566) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACAAAAATCTTCAAAACGACTAGATCTTCAAGGC right flanking sequence: ATCCGGGCTCTCGCTATTCTAGTTGTTCTTGGCTTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACTAGATCTTCAAGGCATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8900 | sprr-2(sy1569) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of sprr-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGTTTATTGCGGCAATGCGCATGCAGAGCCAAAT Right flanking sequence: AGCTCAGCAGTTCAACAACTTGCAGAAGCATGTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTTGAACTGCTGAGCTATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8902 | npr-6(sy1571) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-6. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gtaatttttattttaaaaaaacacgtttcagAACC right flanking sequence: CCATGGAAATGGAATATTTCCGCCCATTCTTTATTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACACGTTTCAGAACCCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8934 | oac-30(sy1577) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-30; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattttgaaacttgctgaaattttcagATTCCGCCG Right flanking sequence: AATCCTGCCACTCTACTATCTCCTCATCTTCTTAA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGTAGAGTGGCAGGATTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8936 | otpl-2(sy1579) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATGAAAATATGAAACGTTGGACGAAAAACCCGGAA Right flanking sequence: GCAAGgtaaaaagggaataactcaatataattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGACGAAAAACCCGGAAGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8938 | frpr-12(sy1581) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-12. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTTTCCAACTTCTAATGTTCAAAGTTACACCTTGA right flanking sequence: ATGAAGTGTTTTCAATGGTTATGCTACCAATTATT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATTGAAAACACTTCATTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8940 | otpl-3(sy1583) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCGTCAAATTGTTCTACAATTGCAACACCCAAC Right flanking sequence: AGCAAAGTCAGATTTCGGTATCATGAGAAACGATATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAAATCTGACTTTGCTGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8942 | otpl-4(sy1585) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-4 ; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTCAATTGTTTTTTATATTATTCTGGGACTGACA Right flanking sequence: TCGTGGAAAAAGgtgagaatagcaagatttattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTATTCTGGGACTGACATCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8943 | otpl-5(sy1586) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGAGCACAAGCACATCGGTAGCAATGTCCACAT Right flanking sequence: CAGACGGGTTCAGTAGCCATGACGATATTTCACAATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTACTGAACCCGTCTGATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8945 | otpl-6(sy1588) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-6; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGAATCTACATCCAGCGATGTTACTGTCCTAAC Right flanking sequence: AGACTATAGCAGTACTATTCCAGAAAATCTTCCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAGTACTGCTATAGTCTGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8988 | otpl-7(sy1590) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-7; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGTCAGTGTTGCGAGTACATCAACAGCCCCACTT Right flanking sequence: GATCATGTCACAGTTCCAAATGCTCTTCCATCAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAACTGTGACATGATCAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8990 | otpl-8(sy1592) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATCACCCACACATCATCATGAACTCTACCGACGA Right flanking sequence: CCTTGGATTCATGAGCCAAGAGCCACgtaagtctag inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATGAACTCTACCGACGACCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8992 | msp-3(sy1594) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTGGACCCAAAGGAAGCTGTGCTTCTTGCCGTGT Right flanking sequence: CATGCGATGCCTTCGCCTTCGGACAGGAGGACAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGCGAAGGCATCGCATGACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8997 | flp-1(sy1599) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACTCTGCTCTACCAAGTAGGGTTATTACTCCTTGT Right flanking sequence: GGCAGCTACTTATAAGgtttctttcttgatttaat inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CCTTATAAGTAGCTGCCACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9030 | syIs742; syIs300. | C. elegans | syIs742 [Y41C4A.6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS9031 | syIs743; syIs300. | C. elegans | syIs743 [pks-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for CAN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS9034 | syIs686. | C. elegans | syIs686 [gpa-4p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASI neurons. |
| PS9035 | syIs734. | C. elegans | syIs734 [sre-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADL neurons. |
| PS9046 | syIs612. | C. elegans | syIs612 [15xUAS::GCaMP7b::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. In vivo calcium indicator cGAL effector. |
| PS9048 | msp-40(sy1604) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-40; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACACCCCGGATGGAGCTGCTAAGCAATTCCGCCG Right flanking sequence: TGAGTGGTTCCAAGGAGACGGCATGGTTCGTCGTAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCTTGGAACCACTCACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9050 | flp-4(sy1606) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-4. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACGTTGCTTGCACTCACAGCAGCTCATCCACCGTC right flanking sequence: ATCTGGTGAAGAAATTGCTGAGCAAGAAGAGAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCAGCTCATCCACCGTCATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9052 | flp-22(sy1608) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-22. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTTTGTGTTGTTTTGATGGTATCATTGGTGTCGG right flanking sequence: CTCAGGTCTTCGATTTGGATGGACAACAGTTGGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTATCATTGGTGTCGGCTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9058 | shl-1(sy1614) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of shl-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTTCGAGACAGCCCATGCCACAGGCCCCAGTTGCAA right flanking sequence: TACAGgttaggtttggtgggaataattttctaaat inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGGCCCCAGTTGCAATAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9191 | kvs-4(sy1622) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kvs-4. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gttcctaacatgattgttgaaaataattttccagAA right flanking sequence: GCACGGAGGAGGAGCGACGCACAGTGCAGACAGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCGCTCCTCCTCCGTGCTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9192 | mgl-1(sy1623) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of mgl-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGCACTTATTCTTGATTCATGCTCAAATCCAGCA right flanking sequence: TATGCGCTAAACCAGAGTTTAGATTTTGTGAGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTCTGGTTTAGCGCATATGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9195 | col-46(sy1626) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-46. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCGTTTATTGTTTCTGTAGGACCCCTTGCCTCAA right flanking sequence: TACTTCGACCGGCTATTCAGAATACTGTCAACGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATAGCCGGTCGAAGTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9197 | col-40(sy1628) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-40. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: aactattttcagGTCGAATTCTGCAAGCACCGAAC right flanking sequence: TGACGGACTCTGGGATGAGTTCCACAGAgtaagta inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGCAAGCACCGAACTGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9199 | col-54(sy1630) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-54. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTCTTCTTGTTGCTGGATCATTATTCTTTGAAGC right flanking sequence: TCAAGGATTTTTAGAGACTTCACTTGATGAAATTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCATTATTCTTTGAAGCTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9201 | col-133(sy1632) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-133. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGCAAGCACTCTGCTCGTGACATTTTCGCCGAGG right flanking sequence: TAAACCACATCCGTTCTTCACCAAAGAACGCTTCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGAACGGATGTGGTTTACCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9229 | syIs748; syIs300. | C. elegans | syIs748 [tbh-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS9232 | syIs751; syIs300. | C. elegans | syIs751 [ttr-39p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for DD and VD neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS9235 | syIs768; syIs300. | C. elegans | syIs768 [aqp-6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for IL1 neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS9355 | col-102(sy1735) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-102. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATGAGGTCTCTCAAGATCTTACACAATTCCGTGG right flanking sequence: ATACTATGATGATGCGTGGAGAACCATGATGGTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGCATCATCATAGTATCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9359 | col-114(sy1739) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-114. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCAAGCAGCTCATTAATACTGAAGTTGTCTCTT right flanking sequence: AGgtaagattaatgaaccatgtgaataatatg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACTGAAGTTGTCTCTTGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9361 | oac-19(sy1741) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-19. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTCTTGCTATAATTGCAGTTCTAGGCTTCCACTT right flanking sequence: CTACCCTGACACCTTCCCAAATGGATATCTTGGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAAGGTGTCAGGGTAGAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9362 | oac-45(sy1742) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-45. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTTGGATTTCATTTCTACCCTAATCAGTTTCCC right flanking sequence: AATGGGTACCTTGGAGTTGATCAgtaaggtttttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCCTAATCAGTTTCCCAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9363 | col-116(sy1743) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-116. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATTTCCGCAGTTTCAATATTTGGTGCCCTAT right flanking sequence: GTGTGGCAGCTTCAATTTTAGTTGGTATTAACGAA inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATATTTGGTGCCCTATGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9364 | col-109(sy1744) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-109. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatcaccttttcccccattcgttttttccagTC right flanking sequence: GACCGCCAGAGATATCATGTCTGAAATCAGTCACAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATATCTCTGGCGGTCGAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9366 | srx-12(sy1746) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-12. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCATTGCAAATTTTGGGGTTCTATTTGTATTCTGC right flanking sequence: ACATGGGTCACGCCGACCACTATTATgtaggtttttg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTATTTGTATTCTGCACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9374 | sra-14(sy1748) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of sra-14. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCAATCGGGTGTTTTGTTGGAGTTGCCTACT right flanking sequence: GTATAAGGTTTATGCGGAAACACCCGATTTTCAGCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCGCATAAACCTTATACAGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9376 | srg-48(sy1750) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-48. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTCTCCAGAACTATTCAATTTCTTCATGTTTTGCG right flanking sequence: GGCTGGCATTTCTTCATCTTCAGTCATGTAGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTTCATGTTTTGCGGGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9378 | srv-28(sy1752) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srv-28. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTATACTATGGAATGTCGATTTTAAGTCTTCCCTTATA right flanking sequence: CTTTGGTGTTCTCATTTGTTTGTTGAGATTGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTAAGTCTTCCCTTATACTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9380 | kcnl-2(sy1754) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. left flanking sequence: GTGATGTAAACGAAATTCCAAAAACGAATGGAGG right flanking sequence: AGGACATCCAATTGTTAGAAGAAAAAGTGGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCAAAAACGAATGGAGGTCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9381 | kcnl-2(sy1755) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: GAATGGAGCAATTGGAGATGATTCAACAGTTCCAT right flanking sequence: TGATGGACGAAAAAGATGATAACAGgttagttattc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATTCAACAGTTCCATTGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9391 | syIs802 X. | C. briggsae | syIs802[Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS9392 | syIs803 II. | C. briggsae | syIs803 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS9393 | syIs804 X. | C. briggsae | syIs804 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS9396 | syIs807 IV. | C. briggsae | syIs807 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS9419 | col-131(sy1765) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-131. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTTTCGGTGCTGGTATTTGTCCTTCAGACCAAGA right flanking sequence: ATGATTTGGACCAAGTTTGGGCCGAGTTTGATCAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTTGGTCCAAATCATTCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9421 | col-158(sy1767) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-158. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GACCGCCGGGGCTTTGTGCCTCTCCTCGGCCACTC right flanking sequence: TCATCCTCTCGCTTTATGCAATTTTCTCAATTTATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATAAAGCGAGAGGATGAGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9432 | syIs785. | C. elegans | syIs785 [15xUAS::TeTx::SL2::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] Neurotoxin cGAL effector. |
| PS9435 | syIs788. | C. elegans | syIs788 [srt-28p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC-OFF neuron. |
| PS9441 | syIs794; syIs337. | C. elegans | syIs794 [F47D2.11::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. |
| PS9443 | syIs796; syIs300. | C. elegans | syIs796 [F35D11.1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, F09E10.7p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for CEP neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS9445 | syIs798. | C. elegans | syIs798 [srt-47p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC-ON neuron. |
| PS9458 | srv-8(sy1771) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srv-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTTATTTTGTAGAAATACAAATTTTATTCACT right flanking sequence: TCGAGGAATTCTACTTTCAAAGgtcagagaagata inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACAAATTTTATTCACTTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9460 | col-2(sy1773) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTTGTCGCCGTTGTCTCTGTTTTCATCACATTGC right flanking sequence: CAATGGTTTATAACTATGTTAATAATGTGAAGAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTTTCATCACATTGCCAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9464 | srg-6(sy1777) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-6. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ATTTCAAAAATGATTTACGTGATACAAGTGAAACA right flanking sequence: TCGAGGTGATTATCATGAACAGAGGCGGTTTTGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGATACAAGTGAAACATCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9466 | fbxa-199(sy1779) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of fbxa-199. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGTTTACTATTTTAACTGTTGGCCTGGCAACTTC right flanking sequence: GGACGGCGTGTTTTCAACGCTGTACTTGTTTTACG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTGGCCTGGCAACTTCGGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9467 | col-37(sy1780) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-37. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATCCATGTGATGACCGATATTAGCAACTTCCAAG right flanking sequence: ATGAGGTTATCTCCGATTTAAGCAATTTCAAGCAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTAGCAACTTCCAAGATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9469 | col-43(sy1782) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-43. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTATGCTGCCGTCTCATTCTCAATTGTGGCCGTTC right flanking sequence: TTTCGGTGGTGCTCACACTACCAATGGTCTACAAT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTCAATTGTGGCCGTTCTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9485 | col-36(sy1783) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-36. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTTGCGGTTGCTGTCTCAACTGCAGCCGTCATT right flanking sequence: TCAAGgtaattaaaaacttcactcttcagattatc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAACTGCAGCCGTCATTTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9487 | srd-32(sy1785) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srd-32. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACCATATACTGTATTCTTGGCGAACACCTCTA right flanking sequence: TAACGCAGCTAGGGTATTGCATATGTTTCCTCTTAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATACCCTAGCTGCGTTATAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9491 | col-45(sy1789) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-45. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGCCGGGACGAGGAGCTCGTGGCCCGAACCAAGC right flanking sequence: GAGCGGTTAAAGGCACATGGCTCTTCGGACAGTAT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGTGGCCCGAACCAAGCGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9494 | col-73(sy1792) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-73. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GACCAGATGCTCCAAATGAGCACGTTCAACCAACT right flanking sequence: CCAGCCGATTTCTGCTTCGAGTGCCCACCAGGACC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGCAGAAATCGGCTGGAGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9496 | him-5(e1490) V; seb-3(sy1794) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of seb-3 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATTGAAAAAACTGGAAAACAGTTCGTATAATCCG right flanking sequence: GGgtgggtcaagttccagtgttcagtttttttaaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGTTCGTATAATCCGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9498 | ufd-3(sy1796) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: CTCATCATTCACTGAATTCGTATTTCTGTGATCGTGA. Right flanking sequence: ACGTGGTCAGGAACTTGTCGGAAGATTAATTGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTTCTGTGATCGTGAACG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9500 | ufd-3(sy1798) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. Left flanking sequence: CAATTTCCCATGTTATTGAAGCCCACAAATCCGACA. Right flanking sequence: CAAAGGCTTTGGCAGTTACTCAAGGCGGATGCTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCCCACAAATCCGACACAA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9502 | srsx-40(sy1800) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srsx-40. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTATTTTGACAATCGACAGAATAATTGCCACGT right flanking sequence: GTACACCTATTCAATACAAGAATTTGAAACATTGTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTATTGAATAGGTGTACACG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9504 | him-5(e1490) V; str-74(sy1802) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of str-74 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGGAATATTGTTTTCGGGAATAGAAATCCTTGC right flanking sequence: CAGACCATTCGCTCATAATTATAACAACAGTTTGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATGAGCGAATGGTCTGGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9506 | col-84(sy1804) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-84. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatttttaaagcgaatttttctagCAAGAAACCGACG right flanking sequence: CAATGTGGAAGGATTTGGTTCAAATTGGCACCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAATCCTTCCACATTGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9508 | kvs-2(sy1806) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kvs-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAATTGGTGAATCAAGGAGCACGACGATCACACATGA right flanking sequence: TTCCGgtttgattttcattgaattcgtgggaac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGACGATCACACATGATTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9520 | nlp-21(sy1807) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaaattgatactatgaaacattatatttccagCG right flanking sequence: CTTGTCATGGTGCTCAACGCCCAATACACTTCCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGAGCACCATGACAAGCGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9527 | tns-1(sy1813) I. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tns-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTCTCTAGAGTTATACAAAGACAAATTAGTGGTGC. Right flanking sequence: AGGAGGTGGAATTCTAAAGAAGAGTAATGGAAAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGACAAATTAGTGGTGCAGG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9529 | him-5(e1490) V; nlp-49(sy1815) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-49 into parental strain CB4088. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTGCTTTTGGCTGTTTTCTGCATTGCTGCCTAT. Right flanking sequence: CCTGGGCTGATGGGgtatgttccaatattgaacc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGCATTGCTGCCTATGCCT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9534 | syIs799; syIs300. | C. elegans | syIs799 [F58F6.6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS9538 | syIs824. | C. elegans | syIs824 [15xUAS::Chrimson::tdTomato::let-858 3'UTR + myo-2p::GFP + 1kb DNA ladder (NEB)]. Red light-activated channelrhodopsin cGAL effector. [NOTE: due to an error in the information submitted to the CGC, this strain was previously described as carrying the array syIs803 with a ttx-3::RFP co-injection marker. The correct name for the array is syIs824 and it carries the myo-2p::GFP marker.] |
| PS9542 | syIs807; syIs337. | C. elegans | syIs807 [pps-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. |
| PS9547 | syIs812; syIs337. | C. elegans | syIs812 [srj-26p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. |
| PS9550 | syIs815; syIs337. | C. elegans | syIs815 [nlp-76p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. |
| PS9551 | syIs816; syIs300. | C. elegans | syIs816 [ocr-4p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for OLQ neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS9589 | fkh-2(sy1839) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of fkh-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCCATCAAAGACAGTCCAGAAAAACGTCTCACATT. Right flanking sequence: GGCTGGAATTTACGAATACATCGTCACCAATTACC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GAAAAACGTCTCACATTGGC Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9594 | nlp-8(sy1844) I. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gttttcagTGCCTTCTTATCGGCTTTACTGCCGCCT. Right flanking sequence: ACCCCTACCTGATCTTTCCTGCTTCACCGTCCTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAGATCAGGTAGGGGTAGG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9663 | syEx1708; syIs300. | C. elegans | syEx1708 [dat-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for dopaminergic neurons (CEP, ADE, PDE). syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS9664 | syIs300; syEx1709. | C. elegans | syEx1709 [arrd-16p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Pick animals with RFP expression in coelomocytes to maintain. cGAL driver for URY neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS9665 | syIs300; syEx1711. | C. elegans | syEx1711[nlp-20p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. |
| PS9666 | syIs300; syEx1712. | C. elegans | syEx1712[T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. |
| PS9668 | syIs300; syEx1714. | C. elegans | syEx1714 [flp-11p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, seb-3p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for OLL neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. |
| PS9672 | syIs300; syEx1718. | C. elegans | syEx1718 [kcnl-4p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + F58F6.6p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Pick animals with RFP expression in coelomocytes to maintain. Split cGAL driver for PHC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. GFP cGAL effector. |
| PS9673 | syIs300; syEx1719. | C. elegans | syEx1719 [kcnl-4p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + Y48G10A.6p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Pick animals with RFP expression in coelomocytes to maintain. Split cGAL driver for FLP and PVD neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. GFP cGAL effector. |
| PS9675 | syIs840; syIs300. | C. elegans | syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs840 [T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons. |
| PS9676 | syIs841; syIs300. | C. elegans | syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs841 [nlp-20p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons. |
| PS968 | unc-101(sy216)/hIn1 [unc-54(h1040)] I. | C. elegans | Heterozygotes are WT and segregate embryonic lethals (sy216 homozygotes) and paralyzed Uncs (h1040 homozygotes). sy216 is a deletion of the unc-101 gene region. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS9705 | asp-12(sy1899) V. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of asp-12. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAATCGCCAAAGATGCAAATGATGAGGCGAGGAGA. Right flanking sequence: ATGGGGAGCATACGTTCAACACAAGGCTGCCCTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGATGAGGCGAGGAGAATG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9707 | haf-6(sy1901) I. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 2nd exon of the gene. Left flanking sequence: catatattttcccgttttttgcagCTTTTCCAGCT. Right flanking sequence: ATCCATGGCTTCACAAACCGATTTCAAGGACAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTGTGAAGCCATGGATAGC Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9711 | col-110(sy1737) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-110. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGGTTTTGACGGTTGGAGCAATGGTAACCCTTCC right flanking sequence: ACTAGCCTATCATTATGTTAATCAGTTGAGAAATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATAATGATAGGCTAGTGGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9712 | ins-32(sy1905) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-32 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttgtctgaaaATGACCTCGATTCTGTTGATCCTTC. Right flanking sequence: TATTGGTTATCACCGTCACCGGGATGTTCCAGGAG Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GATTCTGTTGATCCTTCTAT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9714 | haf-6(sy1907) I. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: ctctgcactggattcccattcggagcacATGGTAC. Right flanking sequence: AAGAGGCGTTGAATAATGTGATGAAGGGCCGAACTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCGGAGCACATGGTACAAG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9716 | tat-3(sy1914) III. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tat-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGTGGCAGAATCCTAAAAACGCATCCAGTAACA. Right flanking sequence: CGATGGCTGTTCCCAACTCAACCCATGCTTCCAC Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACGCATCCAGTAACACGA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS976 | lin-48(sy234) III; him-5(e1490) V. | C. elegans | Lineage defects in B, F & U blast cells resulting in abnormal spicules and ectopic spicule cells. F34D10.5 rescues lin-48(sy234); it encodes a C2H2 zinc finger protein similar to Drosophila ovo. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS9808 | mgrn-1(sy1915) X. | C. elegans | Superficially wild type but some including Pvl or Dpy phenotypes, poor locomotion, slow growth and sometimes ruptured. CRISPR/Cas9 engineered STOP-IN null mutant of mgrn-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGGAACACACACGAGCGGGGAAACTCGCACGATG. Right flanking sequence: ATGAGGACCCCGAAGCACAGATAACGTTCTCCAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGGAAACTCGCACGATGATG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9809 | C01G6.4(sy1916) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C01G6.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGGTTCGTCAGACAGCACGATGAGACGCCACTA. Right flanking sequence: CGACGgtaatttactttgtcattcactagtatactg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGATGAGACGCCACTACGA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9811 | C15C8.4(sy1918) V. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C15C8.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATCGGCGCACAACAAGAAAACACAGTATCGAACG. Right flanking sequence: GAACGGATCAACTTCATTTACGAAAAGGCATTGCAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACACAGTATCGAACGGAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9813 | C03H5.4(sy1920) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C03H5.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCAATTTATGACACGTTGTATGACGCACCATGAT. Right flanking sequence: GCTTGGgtgagaaatttttaaagttctaaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTATGACGCACCATGATGCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9815 | C07E3.9(sy1922) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C07E3.9. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTCAACGACTTGCTATTGCACCAATCCGAGAC. Right flanking sequence: TGAAGGCTCTCTGGAACCTGGAGGAGGTCGCTGAATG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGCACCAATCCGAGACTGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9817 | srh-30(sy1924) V. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of srh-30. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCACTTATATTACTATCCTAAATTTTATTCCGATA. Right flanking sequence: GTCACAGTTCCAATTTATGCGGAAGCAATTTACTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAAATTGGAACTGTGACTAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9852 | C15H9.5(sy1935) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C15H9.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTATCTCCACAATAACAGGGAAATTTCACCATTT. Right flanking sequence: GGCATTGAGGgtttgtaaaaatattaaataaacaag. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACAAACCCTCAATGCCAAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9854 | C16A11.2(sy1937) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C16A11.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTATCTCCACAATAACAGGGAAATTTCACCATTT. Right flanking sequence: CAATGGATGCGAAATGCACGTTGGCTGAATATGTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGCAATGTTTAATCTTTCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9855 | C18B12.4(sy1938) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C18B12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGAAGAAGAATTAGTGCATAAATGTTTGGCGAA. Right flanking sequence: AGGTGGAAATTTTGGAATGGATGTTTCGGATTTTATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATAAATGTTTGGCGAAAGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9857 | C17F4.8(sy1940) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C17F4.8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTTCAAACTTCCAAGTCTACTCTCACCATGAT. Right flanking sequence: CGACGGATTCTTTAAGATGATGCTCGAGAGTGAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCTACTCTCACCATGATCGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9858 | C18F10.7(sy1941) III. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C18F10.7. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTGGATTCGCCAGCGAAACTCGAATTCCCTCTA. Right flanking sequence: CACTGGGCAGTGTACGTCGACTGCAAGGATGAGCTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTCGAATTCCCTCTACAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9860 | C24A3.1(sy1943) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C24A3.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagACCGTCCGGGCAAGGACCTAAAGCACCAAAA. Right flanking sequence: GAAGGGCATGCGGTTACACCAAAGgtaaactatttatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAACCGCATGCCCTTCTTT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9868 | C26B9.5(sy1945) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C26B9.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACTCCGAGTCAGCACGGCATCCCCACTTGCCACCG. Right flanking sequence: TATCTACTGGGGCGACCTACTGAACATGGATTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTCGCCCCAGTAGATACGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9870 | F01D5.7(sy1947) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F01D5.7. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGCCTTCTATGCTACGTCGCATGCCCACCCATCC. Right flanking sequence: CATCGGAAATCATCCGGAAATTGGCATTCCACCCG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGCATGCCCACCCATCCCAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9872 | C31E10.5(sy1949) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C31E10.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCCCTCCAACTCCGCACGACAATTTGGTGGAGC. Right flanking sequence: GATTGGTGCTTGCAGGATGCAATTTGAATCGAGTAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGACAATTTGGTGGAGCGAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9874 | C31E10.6(sy1951) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C31E10.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGACCGTAAATTCTACAATAACTGGAAAGCCATTG. Right flanking sequence: AGCACTTTCCACGAGGTTATTCTGCATCAACTTTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCTCGTGGAAAGTGCTCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9876 | F18A11.5(sy1953) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F18A11.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGTAGTAATCTCAGCGAACGAGTTCTGCTGAATGT. Right flanking sequence: TGGCGGCAAAAAGTTCGAGACTACGGTCGCCACG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGAGTTCTGCTGAATGTTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9880 | C33A11.2(sy1955) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C33A11.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTATCGCAGTGCTCAAACACGACGTCGATCCAATC. Right flanking sequence: TTCCCGTACCTCTCGTCGGCCGCCGACAAACGTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACGAGAGGTACGGGAAGAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9882 | F09B12.5(sy1957) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F09B12.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gaactaaaaattgcagATGAAACGTGTGCCGACG. Right flanking sequence: GTCAATTTCGATGTAGCAATGGAAGGTGTATAACG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCTACATCGAAATTGACCGT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9884 | srx-43(sy1959) V. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAACCTTCGTGTACTCAAGTGATGACGCGCTGGCAG. Right flanking sequence: GGATGGTAGTTTCAATGgtaagtcaataaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATGACGCGCTGGCAGGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9886 | srg-36(sy1961) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-36. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAGTCTACGGAGCAGCACTACTAGTTCTGTACACCT. Right flanking sequence: ATGTGGTCATCATCATCATTGCACATAAAAAGTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTAGTTCTGTACACCTATG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9888 | C28G1.6(sy1963) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C28G1.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGTTTGTGCATCAAAACTATTCGAAAACCCCGA. Right flanking sequence: AGTGAAATGTCCAACTTGTCGTCAGCCAATTGAGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGTTGGACATTTCACTTCG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9893 | syIs844; syIs300. | C. elegans | syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs844 [srd-36p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ASK neurons. |
| PS9896 | syIs852; syIs300. | C. elegans | syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs852 [C50F7.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons. |
| PS99 | dpy-20(e1362) IV. | C. elegans | Severe Dpy. Cold sensitive: grow at 20C. Can be used for microinjection because rescued animals are easier to pick out than dpy-20(e1282) rescued animals. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS9926 | F09G2.8(sy1979) V. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F09G2.8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACACTCGAATAGAAGTTCCAACGAGTAAAAACAG. Right flanking sequence: CGGTGGTGACGGAATGCACAGTCCGTATTACGACG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCAACGAGTAAAAACAGCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9928 | F11E6.6(sy1981) IV. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F11E6.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATATTTTTTTGTTTCTCTTCTTAAGAAATATCCTCAT. Right flanking sequence: ATTCTACCGTTTCTTGCGTCCCGTGATGCATCAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCAAGAAACGGTAGAATATG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9930 | C44H4.4(sy1983) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C44H4.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttttttcagATTCACAAAAAACTTGAAGCCCGAGC. Right flanking sequence: AGATATCCTTAGACGTGTTAAAAGGAAATAGTAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACGTCTAAGGATATCTGCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9932 | trap-4(sy1985) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of trap-4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGCCAAAGTACTCGGCCTCGTCATTCTCCACTAC. Right flanking sequence: CGACGGATTCTTCCACTACAAAACCACCTTCATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCGTCATTCTCCACTACCGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9934 | rab-39(sy1987) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of rab-39. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTACCAATATCGTCTTATCGTTATTGGGGATTCAAC. Right flanking sequence: AGTTGGCAAATCTAGTCTTTTACGGTACTTCACAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATTGGGGATTCAACAGT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9935 | cyn-11(sy1988) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of cyn-11. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGATAACCCAATCGTTTTTCTAGAAGTTACCGC. Right flanking sequence: CGGTGGTGCACCAATCGGAACTATTGTTgtaagttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTAGAAGTTACCGCCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9957 | lim-8(sy1989) III. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of lim-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ccacttttcagTCAAAAGAAGAAATCCTCCAAGT. Right flanking sequence: GAATTCGGCGTCTCGACCAGCACTGCCACGTCAGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCGAGACGCCGAATTCACT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9959 | F16F9.1(sy1991) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F16F9.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACCATCATATAGCCCTCGCCGCCCTCCTCCACCA. Right flanking sequence: TACGAAGAGCAGAACAATCGAAATGCAAAAAAGgtg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTTCTGCTCTTCGTATGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9961 | imph-1(sy1993) III. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of imph-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACTACAGGCCGTTCAACAGCAACAAGCCCAAC. Right flanking sequence: AGATGCACCATCGTCTTCAAGGAGCTCCGATCAATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGACGATGGTGCATCTGTT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9963 | F26G1.1(sy1995) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F26G1.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCCCGAAAATTCGAAACCGACCCGGATTTGGTAA. Right flanking sequence: TTCCGGCCGTTCAACACCCGTTAGAAGACGCAGAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGACCCGGATTTGGTAATTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9965 | tep-1(sy1997) I. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tep-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGTACAAATGCAGCTGTGGTGTCAACAACCGCGG. Right flanking sequence: CGCCAGTTAAgtaagttctgtaaaatattgatgatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTTACTTAACTGGCGCCG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9979 | dhp-1(sy2005) I. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of dhp-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACCACTTGTTATCAAGAATGGAACTGTCGTCAATGA. Right flanking sequence: AGATGGAATGTTTAAAGCTGATGTTCTTGTTAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAACTGTCGTCAATGAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS998 | goa-1(sy192) I; him-5(e1490) V. | C. elegans | This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS9981 | Y105E8A.2(sy2007) I. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of Y105E8A.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATTCTATTCACTATTATGTGTCATTTACAAGTG. Right flanking sequence: ATTCGGTGACAATAAAAGATCCACCAACACTGGAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGTCATTTACAAGTGATT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9983 | itm-2(sy2009) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of itm-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTGTGCGAGGCTGATGAGGAGAAGCACATCAGTAA. Right flanking sequence: CTGCGGCTGGGTACCAATGGAAGGAGGCAACTTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GAGAAGCACATCAGTAACTG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9985 | sfxn-1.4(sy2011) II. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of sfxn-1.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTCCGCCGATTCTTGCTCGTCTCGTTCCATTT. Right flanking sequence: GCTGCTATTGCATTCGCCAATGCAATTAATATTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCGAATGCAATAGCAGCAAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9987 | F21G4.6(sy2013) X. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F21G4.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATAACGGATGAATTAAGTACAAATGTATCGTTG. Right flanking sequence: GACAGGGAATTAAACCTTTTGAAATCGGCACAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTACAAATGTATCGTTGGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9993 | F22G12.4(sy2022) I. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F22G12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: caccaaaacccaaccaatttccagAGAACCTTTCGG. Right flanking sequence: CAATGGATTTCCTGCTCGGCAACGGAGCCGATGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCCAGAGAACCTTTCGGCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9995 | F33E11.3(sy2024) V. | C. elegans | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F33E11.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATGTTCGATATCAGCGATTGGCTCAGGAGTATA. Right flanking sequence: CGAAGgtgcggacgagaaaattttttttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTGGCTCAGGAGTATACGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9997 | hint-1(sy1567) I; hint-3(sy2026) V. | C. elegans | Superficially wild type. Penetrance lethal with lots of unhatched eggs and slow growth. CRISPR/Cas9 engineered STOP-IN null mutant of hint-3 into hint-1(sy1567) stop-in mutant. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catgttttacaggATGACGTCAATGCATACTTCTGT. Right flanking sequence: TAACGGATGCAAGTTTTGTGACATTGTCAAAAATA. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCAATGCATACTTCTGTTAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| PS9999 | npp-10(sy2071) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | Homozygous sterile CRISPR null mutant balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP sy2071 homozygotes (L2 or early arrested sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. CRISPR/Cas9 engineered STOP-IN null mutant of npp-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATCAAAACAAAGGATTGTTTGGTCAGCCAGCC. Right flanking sequence: AATAACAGTGGAACTACTGGCCTTTTCGGGGCGGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAGTTCCACTGTTATTGGC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| WBVar00249046 | SNP | substitution | |
| sy294 | Allele | substitution | |
| sy574 | Allele | ||
| sy5440 | Allele | ||
| sy29 | Allele | substitution | |
| sy97 | Allele | ||
| sy241 | Allele | substitution | nonsense |
| sy101sy127 | Allele | substitution | |
| sy101 | Allele | substitution | |
| sy127 | Allele | substitution | nonsense |
| sy441 | Allele | substitution | nonsense |
| sy96 | Allele | substitution | splice_site |
| sy254 | Allele | ||
| sy93 | Allele | substitution | |
| sy237 | Allele | substitution | nonsense |
| sy143 | Allele | substitution | nonsense |
| sy129 | Allele | substitution | |
| sy263 | Allele | ||
| sy290 | Allele | substitution | |
| sy277 | Allele | deletion | |
| sy15 | Allele | ||
| sy1 | Allele | substitution | nonsense |
| sy17 | Allele | substitution | splice_site |
| sy247 | Allele | substitution | nonsense |
| sy326 | Allele | substitution | |
| sy328 | Allele | ||
| sy327 | Allele | substitution | |
| sy331 | Allele | ||
| sy291 | Allele | ||
| sy275 | Allele | substitution | |
| sy428 | Allele | substitution | nonsense |
| sy511 | Allele | substitution | nonsense |
| sy549 | Allele | substitution | |
| sy10 | Allele | ||
| sy552 | Allele | ||
| sy433 | Allele | substitution | |
| sy509 | Allele | ||
| sy582 | Allele | ||
| sy606 | Allele | ||
| sy607 | Allele | deletion | |
| sy576 | Allele | substitution | |
| sy605 | Allele | deletion | |
| sy621 | Allele | substitution | |
| sy628 | Allele | substitution | nonsense |
| sy622 | Allele | substitution | nonsense |
| sy557 | Allele | substitution | |
| sy676 | Allele | ||
| sy693 | Allele | deletion | |
| sy665 | Allele | substitution | nonsense |
| sy100 | Allele | substitution | |
| sy702 | Allele | substitution | nonsense |
| sy705 | Allele | substitution | nonsense |
| sy12 | Allele | ||
| sy108 | Allele | insertion | |
| sy99 | Allele | substitution | |
| sy92 | Allele | substitution | |
| sy5445 | |||
| sy155 | Allele | ||
| sy161 | Allele | substitution | |
| sy5341 | Allele | ||
| sy216 | Allele | deletion | |
| sy234 | Allele | substitution | |
| sy192 | Allele | substitution | |
| sy691 | Allele | ||
| sy690 | Allele | ||
| sy695 | Allele | deletion |