Laboratory Information

NamePS View on WormBase
Allele designationsy
HeadPaul W Sternberg
InstitutionCalifornia Institute of Technology, Pasadena, CA
Address California Institute of Technology
MC 156-29
1200 E. California Blvd.
Pasadena 91125
United States
Gene classes apt  ark  bac  brp  cccp  cod  cog  cyl  dnj  fos  goa  gpa  gpb  gqa 
hcd  ipp  lfe  lov  maea  nsh  pepm  pkd  polq  pqn  prc  raf  rok  sli  sno 
son  sos  tpra  trp  ubl  vex  wrb  zbed  lnkn  piit  rmrp  rsef 

Strains contributed by this laboratory

Strain Genotype Species Description
JT47 egl-8(sa47) V. C. elegans
PS1009 unc-101(sy237) I; sli-1(sy143) X. C. elegans This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1032 syDf1/unc-2(e55) lon-2(e678) X. C. elegans Heterozygotes are Lon non-Unc. Df/Df is embryonic lethal. Maintain by picking single Lon non-Unc and check for dead embryos-->Lon non-Unc recombinants that have lost the Df arise frequently. Does not survive long periods of starvation-->survivors tend to be Lon non-Uncs without the Df. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1056 hIn1 [unc-101(sy241)] I. C. elegans Unc. Previously described as hC1 (hC1 also known as hIn1). This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1123 unc-31(e169) IV; syIs1 X. C. elegans syIs1 [lin-3(genomic) + rol-6(su1006)]. Animals are Muv due to overexpression of lin-3. Unknown if unc-31(e169) is present in this strain. See also WBPaper00004853. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1156 Acrobeles sp. wild isolate. Acrobeles sp. Tamarisk, Palm Desert, 11/92. Male/Female strain. Maintain by mating. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1162 Panagrolaimus sp. Panagrolaimus sp. Wild-type Panagrolaimus isolated in Beijing, China, 1991. Male-female strain.
PS1163 Panagrellus redivivus wild isolate. Panagrellus redivivus Panagrellus redivivus. Not hermaphroditic. Sexes separate. Growth Slow. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1258 sli-1(sy129) X. C. elegans Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1259 sli-1(sy263) X. C. elegans Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1378 itr-1(sy290) lin-3(n1058) IV. C. elegans This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1410 let-23(sy15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1411 let-23(sy1) II; sli-1(sy143) X. C. elegans sli-1 is a silent suppressor of the Vul phenotypes of let-23(lf) mutants. sy1;sy143 animals are Hyperinduced. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1423 let-23(sy17) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Reference null allele for let-23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1427 syIs6. C. elegans syIs6 [hsp-16.41p::lin-3]. Chromosomal insertion of the extrachromosomal array syEx23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1461 ark-1(sy247) IV. C. elegans WT at 20C. At 25C, occasional animals with hyperinduced vulva are observed. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1478 unc-3(e151) lin-15B&lin-15A(e1763) X. C. elegans Unc. Muv. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1493 dpy-20(e1362) IV; syIs9. C. elegans syIs9 [pJMGoQL + (pMH86) dpy-20(+)]. Phenotype of dominant activated Go alpha is lethargic and egg-laying defective - phenotype increases in severity as animal matures and ages. Animals frequently wander to the side of the plate. Animals move with decreased amplitude of sinusoidal waves. Dpy and WT revertants are frequent. Linkage unknown. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1524 let-23(sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans 10% of heterozygotes are Muv, 90% are WT. Segregates UncMuv and DpyUncs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1595 lfe-2(sy326) I; lin-3(n1058) dpy-20(e1282) IV. C. elegans sy326 suppresses the sterility of n1058. Dpy. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1631 itr-1(sy290) dpy-20(e1282) IV. C. elegans This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1678 mut-2(?) goa-1(pk62) I. C. elegans
PS1681 dpy-20(e1282) IV; syIs17. C. elegans syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)]. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1702 dpy-20(e1282) IV; syIs20 him-5(e1490) V. C. elegans syIs20 [gpa-1::lacZ + dpy-20(+)] V. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1824 Panagrolaimus sp. Panagrolaimus sp. Panagrolaimus sp. Huntington #1, isolated 7/94. Male-female strain. Populaiton not cloned, many mutant phenotypes. Mates with PS1850.
PS1839 let-23(sa62) II. C. elegans Semi-dominant Muv.
PS1850 Panagrolaimus sp. wild isolate. Panagrolaimus sp. Isolated by Keith Brown and Marie-Anne Felix in 1995 at Caltech, Pasadena, CA. Mates with PS1824. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1922 dpy-20(e1282) syIs24 IV. C. elegans syIs24 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2037 syIs12 II. C. elegans syIs12 [hsp::lin-3 + dpy-20(+)]. "low dose" overexpressor of the EGF repeat of lin-3 under control of the heat shock promoter. Wild type vulval differentiation when grown at 20C. Muv phenotype resulting from heat shock at L2 lethargis. Reference: Katz WS, et al. Cell. 1995 Jul 28;82(2):297-307. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS21 let-23(sy1) II; him-5(e1490) V. C. elegans Viable allele of let-23. Vul. Throws males. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2105 dpy-20(e1282) IV; syIs13. C. elegans syIs13 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2109 dpy-20(e1282) IV; syIs25 X. C. elegans syIs25 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2286 unc-38(x20) lfe-2(sy326) I. C. elegans Fertile Unc-38. sy326 has no phenotype on its own. Suppresses sterility of let-23(sy10) and lin-3(n1058). Sterile in double mutant combination with lfe-1 alleles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2366 itr-1(sy328) unc-24(e138) IV. C. elegans Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2368 itr-1(sy327) unc-24(e138) IV. C. elegans Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2399 dpy-20(e1282) IV; syIs30 X. C. elegans syIs30 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2442 dpy-20(e1282) IV; syIs44 V. C. elegans syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Non-Dpy. Upon heat shock, two intense spots of nuclear fluorescence due to lacO in the chromosome, and a diffuse nuclear fluorescence due to nuclear-localized GFP-lacI. Array derived from Fire Lab vector pPD49-78 and dpy-20 rescuing construct pMH86. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2444 dpy-20(e1282) IV; syIs36. C. elegans syIs36 [(pLB2) egl-30(+) + pBS + (pMH86) dpy-20(+)]. Integrated version of syEx126 (egl-30 over-expressing line). Easily reverted. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2467 dpy-20(e1282) IV; syEx178. C. elegans syEx178 [hsp16.1::egl-5 + (pMH86) dpy-20(+) + pBS]. Heat-shock egl-5. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2512 itr-1(sy331) unc-24(e138) IV. C. elegans Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2516 itr-1(sy291) unc-24(e138) IV. C. elegans Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2571 cog-1(sy275) II. C. elegans Egl, Pvl, Cog (connection to gonad defective). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2582 itr-1(sy290) unc-24(e138) IV. C. elegans Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2627 dgk-1(sy428) X. C. elegans Pale, scrawny appearance, probably due to starvation. Hyperactive, backs frequently, egg laying constitutive, slow pharyngeal pumping. Probably null (based on sequence, S. Nurrish). Suppresses activated GOA-1 and partially suppresses egl-3(rf). Lethal in combination with eat-16(rf). Previously called sag-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2670 klp-6(sy511) III; him-5(e1490) V; syIs33. C. elegans syIs33 [gpa-1::GFP]. Labels the spicule neurons in males. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2728 sli-1(sy143) X. C. elegans Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2746 dpy-20(e1282) IV; syEx234. C. elegans syEx234 [let-23::GFP + pBS + (pMH86) dpy-20(+)]. Non-Dpys bear the transgene and express GFP in multiple cells including the and uv1. Maintain by picking Non-Dpy. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2767 hmg-1.2(sy549) III; dpy-20(e1282) IV; syIs20 him-5(e1490) V. C. elegans syIs20 [gpa-1::lacZ + dpy-20(+)] V. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::GFP] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2943 hmg-1.2(sy549) unc-32(e189) III; syIs20 him-5(e1490) V. C. elegans syIs20 [gpa-1::lacZ + dpy-20(+)] V. Unc. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::GFP] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS295 let-23(sy97) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2958 syIs46 II; ncl-1(e1865) III; dpy-20(e1282) IV; him-5(e1490) V. C. elegans syIs46 [dpy-30::S65T::lacI + hsp-16p::GFP::lacI + dpy-20(+)] II. Animals are Ncl, Him and Non-Dpy. Heat shock results in diffuse nuclear GFP expression from Fire Lab vector pPD49.78::LacI in most cells. Also see some consitutive GFP expression in embryos from dpy-30 promoter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3003 dpy-20(e1282) ark-1(sy247) IV. C. elegans Dpy. WT vulva at 20C. At 25C, occasional animals with hyperinduced vulva are observed. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS302 let-23(sy10) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS312 Pristionchus pacificus wild isolate. Pristionchus pacificus WT strain, Pristionchus pacificus. Hermaphroditic. See also WBPaper00002887. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3151 lov-1(sy552) II; him-5(e1490) V. C. elegans Hermaphrodites are WT. Males are defective in response and vulva location mating behaviors. Low mating efficiency with non-Unc hermaphrodites. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3170 dpy-17(e164) hmg-1.2(sy549) III; syIs20 him-5(e1490) V. C. elegans syIs20 [gpa-1::lacZ + dpy-20(+)] V. Dpy. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::GFP] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3232 cyl-1(sy433) V. C. elegans Appears WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3233 affl-2(sy509) III. C. elegans Defects in egg laying. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3239 dpy-20(e1282) syIs49 IV. C. elegans syIs49 [zmp-1::GFP + (pMH86) dpy-20(+)] IV. Non-Dpy. Expresses GFP in anchor cell at L3 stage. VulA at late L4, and VulE soon thereafter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3351 dpy-20(e1282) syIs17 IV. C. elegans syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)] IV. Non-Dpy animals which at all stages progressively exhibit Go(gf) phenotype after heat shock treatment (standard treatment is 33C water bath for 30 minutes). Animals cease feeding, foraging, locomotion, ovulating and egg laying. Gravid adults eventually bag. "Suicides" are common. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3352 syIs50. C. elegans syIs50 [cdh-3::GFP + dpy-20(+)]. Line is a slightly Dpy, but appears healthy. Reference: Pettitt J, et al. Development. 1996 Dec;122(12):4149-57. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3398 lov-1(sy582) II; pkd-2(sy606) IV; him-5(e1490) V. C. elegans Double mutant phenotype resembles that of the single mutants. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3401 lov-1(sy582) II; him-5(e1490) V. C. elegans Hermaphrodites are WT. Males are defective in response and vulva location mating behaviors. Low mating efficiency with non-Unc hermaphrodites. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3411 cog-1(sy607)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Pvul Sterile cog-1 homozygotes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3465 unc-38(sy576) unc-29(e1072) I; unc-64(e246) III; him-5(e1490) V. C. elegans Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3475 unc-119(ed4) III; syIs51 V. C. elegans syIs51[cdh-3::CFP + unc-119(+)] V. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3476 unc-119(ed4) III; syIs52 X. C. elegans syIs52[cdh-3::cfp + unc-119(+)] X. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3504 syIs54 II; unc-119(ed4) III. C. elegans syIs54 [ceh-2::GFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3506 syIs56 V. C. elegans syIs56 [ceh-2::YFP + unc-119(+)] V. Expressed in vulB and vulC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3517 unc-119(ed4) III; syIs57 X. C. elegans syIs57 [cdh-3::CFP + unc-119(+)]. Unsure if unc-119(ed4) remains in the background. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3525 syIs59 X. C. elegans syIs59 [egl-17::CFP + unc-119(+)] X. Expressed in vulC and vulD. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3526 syIs60 II; unc-119(ed4) III. C. elegans syIs60 [F47B8.6::GFP + unc-119(+)] II. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3527 syIs61 V. C. elegans syIs61[F47B8.6::GFP + unc-119(+)] V. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3528 syIs51 V; syIs55 X. C. elegans syIs51 [cdh-3::CFP + unc-119(+)] is expressed in vulC, vulD, vulE and vulF. syIs55 [ceh-2::YFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3551 hsf-1(sy441) I. C. elegans Defects in egg laying. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3653 ipp-5(sy605) X. C. elegans Subtle ovulation defect which is viewable by Nomarski - 2 oocytes ovulate (pass into uterus) at the same time. Double mutants with lfe-2(sy326) and lfe-1(sy290) show sterility. Double mutant with lin-3(n1058) is fertile. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3662 syIs63. C. elegans syIs63 [cog-1::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3664 unc-119(ed4) III; syIs65 IV. C. elegans syIs65 [pT100.18(B0034.1::pes-10::GFP) + unc-119(+)] IV. unc-119(ed4) may have been crossed out. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3665 syIs66 II; unc-119(ed4) III. C. elegans syIs66 [B0034.1::pes-10::GFP + unc-119(+)] II. Expressed in vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3666 syIs67 V. C. elegans syIs67 [zmp-1::pes-10::cfp + unc-119(+)]V. Expressed in vulA and vulE. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3667 unc-119(ed4) III; syIs68 IV. C. elegans syIs68 [zmp-1::pes-10::CFP + unc-119(+)] IV. Expressed in vulA and vulE. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3720 unc-119(ed4) III; syIs75. C. elegans syIs75 [lin-18::GFP + unc-119(+)]. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3721 syIs76 IV. C. elegans syIs76 [zmp-1::pes-10::CFP + unc-119(+)] IV. Expressed in vulA and vulE. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3722 unc-119(ed4) III; syIs101 IV. C. elegans syIs101[T04B2.6::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3724 unc-119(ed4) III; syIs102 X. C. elegans syIs102[T04B2.6::cfp + unc-119(+)] X. Expressed in vulB and vulD. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3728 syIs77 II. C. elegans syIs77 [zmp-1::pes-10::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3729 unc-119(ed4) III; syIs78. C. elegans syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3747 ipp-5(sy605) X; syEx429. C. elegans syEx429 [ipp-5p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Construct pIP5 contains 2.0 kb promoter fragment upstream of ipp-1 driving GFP expression in distal spermatheca (in adults); pharynx and vulva (all stages). [NOTE: the syEx429 array in this strain was previously incorrectly annotated as carrying ipp-1p::GFP. The array contains an ipp-5p::GFP transgene.] This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3800 egl-19(n582) IV; him-5(e1490) V; syEx468. C. elegans syEx468 [myo-3p::egl-19::GFP]. C-terminal GFP fusion. Pick GFP+ to maintain.
PS3802 unc-38(sy576) I; him-5(e1490) V; syEx470. C. elegans syEx470 [myo-3::unc-38::GFP]. Pick GFP+ to maintain. unc-38::GFP transgene produced by in vivo recombination between pR29 (myo-3p::unc-38) and pR26 (unc-38::GFP).
PS3808 unc-119(ed4) syIs80 III. C. elegans syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. GFP expression in developing vulval cells, VCs and uterine pi lineage cells. Received new stock 9/2003. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Received new strain from Bhagwati Gupta on April 7, 2008.
PS3818 unc-68(r1158) him-5(e1490) V; syEx475. C. elegans syEx475 [myo-3p::unc-68(see following comments) + myo-2p::GFP + pUC-19]. Pick GFP+ animals to maintain. myo-3p::unc-68 transgene was produced by injecting pEM23 (myo-3 promoter + unc-68 exons 1-8) + 18 kb unc-86 PCR fragment (start codon through nucleotide 18090) + pLM511 (unc-68 position 11989 to the end); fragments were recombined in vivo.
PS3931 ref-1(ok288) II. C. elegans P9.p and P10.p fail to fuse with hyp7 during L1 in hermaphrodites. Misshapen head (low penetrance) and ectopic postdeirid generated by V6 (low penetrance). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3972 unc-119(ed4) syIs90 III. C. elegans syIs90 [egl-17::yfp + unc-119(+)] III. Expressed in vulC and vulD. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3976 lin-17(en671) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); lin-18(e620) X. C. elegans Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile en671 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
PS3996 lin-10(e1439) I; dpy-19(e1259) lin-12(n137)/unc-32(e189) lin-12(n137n720) III; syIs57. C. elegans syIs57 [chd-3::CFP]. Anchor cell present in approx. 1% d/o animals.
PS4064 let-23(sy621sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4076 egl-46(sy628) him-5(e1490) V; lin-15B&lin-15A(n765) X. C. elegans Him.
PS4087 dpy-22(sy622) X. C. elegans Enhances vulval development in the presence of let-23(sa62gf) in hermaphrodites and males. Animals are Dpy. Hermaphrodites are Egl. Males have abnormal ray development. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4110 kfIs1. C. elegans kfIs1[plc-1::GFP]. GFP is expressed in the adult hermaphrodite spermatheca.
PS4112 plc-1(rx1) X; kfEx2. C. elegans kfEx2[plc-1(+) + sur-5::GFP]. plc-1(rx1) homozygotes are semi-Sterile. Animals with the array have normal brood size. To maintain, pick GFP+ worms. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4226 unc-119(ed4) III; syIs53 V. C. elegans syIs53 [pPGF11.07(lin-11::GFP) + unc-119(+)] V. GFP expression in developing vulval cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4230 unc-103(sy557) III; him-5(e1490) V. C. elegans Semi-dominant. 60% of adult males will have protruding spicules; Prc (protraction constitutive) phenotype. Larval animals and adult hermaphrodites do not display any gross abnormal phenotypes. Prc males have a mating efficiency of 0. Non-Prc males have a mating efficiency of 3. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4263 egl-30(md186) I; dpy-20(e1282) IV; syIs105. C. elegans syIs105 [egl-30::GFP + dpy-20(+)]. Translational fusion contains all of the presumptive 5'-transcriptional regulatory sequences, introns, and presumptive 3 regulatory sequences for egl-30, in addition to the coding sequences for GFP just 5' of the egl-30 initiating methionine. syIs105 was found to partially rescue egl-30(md186) with respect to egg laying, movement, pharyngeal pumping, and response to neurotransmitters in egg-laying assays.
PS4264 egl-30(sy676md186) I; him-5(e1490) V. C. elegans Males mate better as heterozygotes. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS427 lin-45(sy96) IV. C. elegans Vulvaless. 90% of the progeny are larval lethal-most die as L1s. Males are mating defective. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4308 unc-119(ed4) III; syIs107. C. elegans syIs107 [lin-3(delta pes-10)::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4309 unc-119(ed4) III; syIs108. C. elegans syIs108 [lin-3(delta pes-10)::GFP + unc-119(+)]. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4330 spe-41(sy693) III; him-5(e1490) V. C. elegans Brood size 13.5 Brood size may increase after many passages. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS436 let-60(sy93) IV. C. elegans Dominant Vul (>99% Egl). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4411 unc-119(ed4) III; syIs123 X. C. elegans syIs123[unc-119(+) + fos-1a::YFP-TL]. Integration of functional fos-1a tagged with YFP at the N-terminus. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS443 Panagrolaimus sp. wild isolate. Panagrolaimus sp. Armenian worm. Male/Female strain. Maintain by mating. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4432 him-5(e1490) V; dpy-22(sy665) X. C. elegans Enhances vulval development in the presence of let-23(sa62gf) in hermaphrodites and males. Animals are Dpy. Hermaphrodites are Egl. Males have abnormal ray development. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4441 syIs118 I; unc-119(ed4) III. C. elegans syIs118 [fos-1a::YFP-TX + unc-119(+)]. YFP inserted into Sal site seven amino acids down stream of start ATG of Cel-fos-L transcript. YFP from plasmid PPD136.64 (Andy Fire's 1999 kit). Promoter is from nucleotide 529 to 8110 of cosmid F29G9. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4444 unc-119(ed4) syIs129 III. C. elegans syIs129 [hemicentin(delta SP)::GFP + unc-119(+)]. Integrant of hemicentin::GFP reporter where the signal has been deleted. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4558 unc-119(ed4) syIs137 III. C. elegans syIs137 [unc-119(+) + fos-1b::CFP-TX]. Integrant of fos-1b transcriptional reporter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4627 let-60(n1046) unc-31(e169) V/nT1 [let(m435)] (IV;V). C. elegans Maintain by picking WT. Segregates Muv Unc (let-60 unc-31 homozygotes), wild-type heterozygotes and dead eggs. Reference: Moghal N, Sternberg PW. Development. 2003 Jan;130(1):57-69.
PS4657 him-5(e1490) V; syIs78. C. elegans syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Not sure if unc-119(ed4) from the parent strain is still present. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS468 let-60(sy100) dpy-20(e1282)/let-60(n1046) unc-22(s7) IV; him-5(e1490) V. C. elegans Heterozygotes are weak Muv and segregate weak Muv, Muv Twitchers, and Dpy Vuls whose progeny are larval lethal. sy100 is a dominant negative allele of let-60. n1046 is a gain-of-function allele of let-60. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4757 bed-3(sy702) IV. C. elegans
PS4758 bed-3(sy705) IV. C. elegans
PS4867 syIs146. C. elegans syIs146 [mom-2::GFP + unc-119(+)]. May contain unc-119(ed4). This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4886 plc-3(tm1340)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm1340 homozygotes (sterile). This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4997 unc-119(e2498) III; syIs179. C. elegans syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS5131 let-23(sy12)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Heterozygotes are GFP+. mIn1 homozygotes are Dpy and GFP+. let-23(sy12) homozygotes are non-GFP. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS524 let-60(sy100) dpy-20(e1282) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are non-Dpy Vul and segregate non-Dpy Vul, DpyVul whose progeny are dead, and dead eggs. sy100 is dominant Vul and recessive Lethal with maternal rescue: homozygotes from heterozygous mothers grow to adulthood and become a bag of dead larvae. sy100 is not 100% penetrant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS529 unc-101(sy108) I. C. elegans Unc. Suppresses the Vul phenotypes of let-23(lf) mutants. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS5332 unc-119(ed4) III; him-5(e1490) V; syIs187. C. elegans syIs187 [pes-10::7XTCF-mCherry-let-858(3'UTR) + unc-119(+)]. Cherry POPTOP. POPTOP expression is best visualized using the mCherry/Texas Red filter. POPTOP transgenes display background expression. POPFOP(sy974) is the control plasmid with mutated binding sites. Analysis of POPFOP should always be used to subtract background expression. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS536 unc-24(e138) let-60(sy99) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are Vul (97% Egl). Segregates dead eggs. sy99 homozygotes are lethal. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS538 unc-24(e138) let-60(sy92) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are Vul and segregate Vul, Unc-24 lethals and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS5527 pop-1(q645) I/hT2 [bli-4(e937) let-?(h661)]; syIs187. C. elegans syIs187 [unc-119(+) + POPTOP]. Heterozygotes are WT and segregate WT and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS5531 Cbr-daf-2(sy5445). C. briggsae This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS5551 pry-1(mu38)/hIn1 [unc-54(h1040)] I; syIs188. C. elegans syIs188 [POPTOP + unc-119(+)]. Maintain by picking non-Uncs. syIs188 suppresses pry-1(mu38) Muv phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS5552 unc-119(ed4) III; syEx974. C. elegans syEx974 [POPFOP + unc-119(+)]. Pick non-Unc and RFP+. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS5647 unc-119(ed4) III; him-5(e1490) V; syIs202. C. elegans syIs202 [vang-1::YFP + myo-2::DsRed + unc-119(+)]; outcrossing suggests array is integrated in LG V. Reference: Green JL, et al. Cell. 2008 Aug 22;134(4):646-56.
PS5970 him-5(e1490) syIs197 V. C. elegans syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.
PS6025 qrIs2. C. elegans qrIs2 [sra-9::mCasp1]. Caspase expression in ASK neuron.
PS6058 pha-1(e2123) III; him-5(e1490) V; syEx1147. C. elegans syEx1147 [des-2::DES-2::GFP + pha-1(+) + pBluescript KS(+)]. Maintain at 25C to select for presence of transgene. GFP reporter is driven by the promoter of the des-2/des-3 operon and is expressed in ALA, RID, PVD, FLP, IL2, PLM, PVC, and M1 muscles of the pharynx. This construct contains 3.4 kb of sequence upstream of the des-2 start ATG (Treinin et al., 1998) (Van Buskirk and Sternberg, 2010).
PS6187 pha-1(e2123) unc-119(ed4) III; syEx1155. C. elegans syEx1155 [myo-3p::tomm-20::mRFP::3xMyc + Cbr-unc-119(+)]. Maintain at 15C. Pick non-Unc to maintain array.
PS6192 syIs243. C. elegans syIs243 [myo-3p::TOM20::mRFP + unc-119(+) + pBS Sk+]. Integrated from PS6053. Strain has been outcrossed, but not known if unc-119 mutation is still present in the background.
PS632 unc-101(sy161) I; let-23(sy1) II. C. elegans Grows slowly with low brood numbers. Sluggish worms. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS6726 unc-119(ed4) III; syIs264. C. elegans syIs264 [col-183p::mCherry + unc-119(+)]. Dauer decision marker that indicates commitment to dauer formation in the hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS6741 pha-1(e2123) III; him-5(e1490) V; syEx1341. C. elegans syEx1341 [ges-1p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the intestine. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in the intestine. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.
PS6742 pha-1(e2123) III; him-5(e1490) V; syEx1342. C. elegans syEx1342 [ges-1p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + unc-122p::mCherry::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the pharynx. Maintain at 25C and pick animals with red fluorescence in coelomocytes. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in pharyngeal muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.
PS6743 pha-1(e2123) III; him-5(e1490) V; syEx1343. C. elegans syEx1343 [myo-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in body wall muscle. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in body wall muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.
PS6744 pha-1(e2123) III; him-5(e1490) V; syEx1344. C. elegans syEx1344 [rab-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed + pha-1(+) + pBluescript]. GFP expression in neurons. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in neurons. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.
PS6745 pha-1(e2123) III; him-5(e1490) V; syEx1345. C. elegans syEx1345 [hsp-16.2p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed + pha-1(+) + pBluescript]. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine upon induction by heat shock. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.
PS6843 syIs300 V. C. elegans syIs300 [15xUAS::Δpes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript].  GFP cGAL effector.  Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6844 syIs301 V. C. elegans syIs301 [myo-2p:NLS::GAL4SC::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  myo-2 cGAL driver for pharyngeal muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6872 syIs302 III. C. elegans syIs302 [15xUAS::Δpes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript].  GFP cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6916 syIs317 II. C. elegans syIs317 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript].  nlp-40 cGAL driver for intestine.  NOTE: Incorrectly annotated as being on LG III in paper; actually should be on LG II.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6934 syIs319 III. C. elegans syIs319 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] III.  nlp-40 cGAL driver for the intestine.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6935 syIs320 V. C. elegans syIs320 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] V.  nlp-40 cGAL driver for intestine.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6936 syIs321 I. C. elegans syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript].  myo-3 cGAL driver for body wall muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6961 syIs334 X. C. elegans syIs334 [rab-3p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  rab-3 cGAL driver for the whole nervous system.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6963 syIs336 X. C. elegans syIs336 [rab-3p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  rab-3 cGAL driver for the whole nervous system.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6974 syIs337 III. C. elegans syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + pBluescript].  GFP cGAL effector.  Weak background fluorescence in some head neurons and the head mesodermal cell.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7044 syIs341 IV. C. elegans syIs341 [15xUAS::Δpes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  channelrhodopsin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7045 syIs342 II. C. elegans syIs342 [15xUAS::Δpes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  channelrhodopsin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7055 syTi1 X. C. elegans syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).
PS7058 syTi2 II. C. elegans syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).
PS7107 syIs373 I. C. elegans syIs373 [15xUAS::Δpes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  Histamine chloride channel cGAL.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7108 syIs374 V. C. elegans syIs374 [15xUAS::(delta)pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  histamine chloride channel cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7127 unc-119(ed4) III; syIs360. C. elegans syIs360 [ets-10p::GFP + unc-119(+)]. Dauer decision marker that indicates commitment to dauer formation in neurons and intestine. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS7136 syIs378 I. C. elegans syIs378 [15xUAS::Δpes-10::mKate2::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  mKate2 cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7149 syIs390 X. C. elegans syIs390 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  GFP cGAL effector.  Weak background fluorescence in some head neurons and the head mesodermal cell.  [NOTE: (03/18/2020) a user has reported syIs390 does not map to LG X] Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7154 syIs391 IV. C. elegans syIs391 [myo-2p::NLS::GAL4SK::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  myo-2 cGAL driver for pharyngeal muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7160 syIs393 IV. C. elegans syIs393 [unc-47p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  unc-47 cGAL driver for GABAergic neurons.  Relatively weak expression. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7167 syIs396 syIs337 III. C. elegans syIs396 [unc-47p::NLS::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  syIs396 is unc-47 cGAL driver for GABAergic neurons.  syIs337 is GFP cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7169 syIs337 syIs398 III. C. elegans syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7171 syIs337 III; syIs400 V. C. elegans syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III.  syIs400 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)] V. syIs337 is a GFP cGAL effector. syIs400 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7172 syIs337 syIs401 III. C. elegans syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs401 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs401 is hsp-16.41 cGAL driver for heat shock promoter. Low levels of GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7185 syIs406 IV. C. elegans syIs406 [15xUAS::Δpes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  GFP::H2B effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7186 syIs407 V. C. elegans syIs407 [15xUAS::Δpes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  GFP::H2B cGAL effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7190 syIs409 X. C. elegans syIs409 [15xUAS::Δpes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript].  mCherry::H2B cGAL effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7192 syIs413 IV. C. elegans syIs413 [15xUAS::Δpes-10::ICE::let-858 3'UTR + unc-122p::GFP + pBlueScript].  Human caspase ICE cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7199 syIs371 III. C. elegans syIs371 [15xUAS::Δpes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  Histamine chloride channel cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7200 syIs420 IV. C. elegans syIs420 [15xUAS::Δpes-10::tetx::let-858 3'UTR + myo-2p::NLS::GFP + pBlueScript].  Tetanus toxin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7201 syIs421 IV. C. elegans syIs421 [15xUAS::Δpes-10::tetx::let-858 3'UTR + myo-2p::NLS::GFP + pBlueScript].  Tetanus toxin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7203 syIs423 V. C. elegans syIs423 [15xUAS::Δpes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)].  GCaMP6s cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS746 let-23(sy97) II; sli-1(sy143) X. C. elegans sy143 suppresses sy97 viability from 15% to 100%, P12 -> P11 transformations from 27% to 14% and Vul from 100% to 3%. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS7731 K03E5.2(sy1082) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG Reference: Wang H, et al. G3 (Bethesda).
PS7734 T05C3.2(sy1080) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAA Right flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7778 clik-1(sy1084) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
PS7783 K03E5.2(sy1086) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7833 Y106G6H.8(sy1076) I. C. elegans Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of Y106G6H.8 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATCTCCCCACCAAGTGTCGATATGTCTCCAATT; right flanking sequence: ATTCGTCTGGCTGGCCTCTCGGGAGCTGTTGCCATTTC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
PS7837 aex-2(sy1078) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATG Right flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7858 C01B10.10(sy1114) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catcatcagAATATGGACCCGCGTGTATGTCCAATT Right flanking sequence: CAACATGGACCCAGAGCCCTCAAAAATGGGTCGATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCTGGGTCCATGTTGAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7898 C53C9.2(sy1116 sy1118)/tmC30 [ubc-17(tmIs1243)] X. C. elegans Superficially wild-type. a weak allele for C53C9.2 ; 58 bp insertion from downstream sequence of its own and 1 bp deletion (leading to change of an animo acid and insertion of 19 amino acids in frame); balanced with FX30326, further confimed by genotyping for homozygotes of C53C9.2 Left flanking sequence ACCGCTGTCGGTATGCCACGTTGGAATATCACCAAG; Right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATCTG; inserted sequence between the two flanking sequence: CTCGGAGAAGACATTCTCCGACGAGGAACCGAATTCACACCATGGTACTCTGGACAAA. sgRNA : GTATCCTTGCTTCTTGTCCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS79 dpy-10(e128) let-23(sy1) II. C. elegans Dumpy. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS7909 C56G2.15(sy1120) III. C. elegans Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C56G2.15. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCGTGAGCATTCACAGAAAAAATCATGCCGTCA; right flanking sequence: GTCCCCTCCAATGTCGTTTTTGTTGCTCAATAAGG; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
PS7911 C53C9.2(sy1122)/tmC30[ubc-17(tmIs1243)] X. C. elegans Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2. lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG; right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
PS7921 unc-119(ed4) III; syEx1539. C. elegans syEx1539 [nhr-246p::GFP + unc-119(+)]. Pick non-Unc to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS7922 C01B10.4(sy1131) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATACACACTTCATTTGGTCATTTGGAAGGTGCAGA Right flanking sequence: GATAGGAGATTATCATTTGTTCAAAAAAATTCCATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATTTGGAAGGTGCAGAGAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7951 adm-4(sy1161) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of adm-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTGATGACACGTTACATCTAGAGCCATCT Right flanking sequence: TACCCGCATCAACTTTCTGATGATCTTGGGCCTGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GAAAGTTGATGCGGGTAAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7953 C23H4.2(sy1163) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C23H4.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattgaaacgaagaccatgccatgcagttccagAG Right flanking sequence: TGTTCCGTTTGCAAAGCCACCAATTGGAAATTTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTTTGCAAACGGAACACTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7960 C04G6.4(sy1165) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C04G6.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGAAGCCACTTTCTTTCGAAATGCCAAAACCGCCA Right flanking sequence: GTTCTCCAGCCAAATATTGCCTCACTTCTACAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATATTTGGCTGGAGAACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7962 ttc-36(sy1167) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ttc-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGCTCAGTTTGCAGCTCGAGAGAGAAGGTGTCG Right flanking sequence: cCGTTGGCAGAAGGTGTACGGTTGGATGAAGCTATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAGAGAGAAGGTGTCGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS80 let-23(sy1) unc-4(e120) II. C. elegans Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS8008 ZC376.2(sy1170) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8010 cpn-4(sy1172) I. C. elegans Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of cpn-4 (F49D11.8). Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCAAGCAAGTTCAATGATGTTGAAGCTGGATACT; right flanking sequence: TGTTGGAATGGATTCGGgtaagatttgggtagatt; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
PS8012 Y55F3BL.4(sy1174) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55F3BL.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGACGACGGATTCACCCTGGTCACTGGTAGAAA Right flanking sequence: AGCCGGAAAACAGTCGGCGAAATTTgtcagttttc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGTCACTGGTAGAAAAGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8027 nlp-67(sy1176) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-67; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTCACTTTCTTGCTCGTCACTCTTTTTGCCCTCGC Right flanking sequence: CAATGTCATGCAAGCACAGCGTTACGATCGAGCC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTGCTTGCATGACATTGGCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8029 R173.3(sy1178) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of R173.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCGAATTGAGGGTCAACTCTGGAGCAATCCG Right flanking sequence: taagtacatgattttttattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTCTTACCAGTCGCTCTCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8031 cest-1.1(sy1180) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of cest-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGGAGACCTTCGATATCGAAAACCCCGTCCACCG Right flanking sequence: AAATCATGGGAAGGAGTTTTGGTAACAAATGAATA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCTTCCCATGATTTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8033 F13H6.3(sy1182) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F13H6.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGGGTACCTCGGGATCCCGTATGCGAAACCACCA Right flanking sequence: GTCGGCGAACTTCGATTTAAGAAGCCAGTAACCGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AATCGAAGTTCGCCGACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8083 syEx1649. C. elegans syEx1649 [nhr-246p::GFP + unc-122p::RFP]. Pick RFP+ (coelomocytes) to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8114 dod-18(sy1190) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-18; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCATTGAAACAGCTAAAGGAAAATTGACGACTA Right flanking sequence: TTGTGGAAGAAATGAAAAGAAAAGAGgtatagtta inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGGAAAATTGACGACTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8116 C17H12.4(sy1192) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C17H12.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGGAAAATTAAGATTTCAAAAACCAGAACCGCCT Right flanking sequence: GAGAAATGGACCGGAGTGAGAAATGCAAAAGgtatg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCGGTCCATTTCTCAGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8118 srx-51(sy1194) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-51; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAACTCATTTGGAATGCTGACTACATCACAGTCTA Right flanking sequence: TTGGGGATGCAGTTATTTCAACAATTTTTGCATTT inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GACTACATCACAGTCTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8120 gnrr-4(sy1196) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gnrr-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGACTGCATCGTTCTCTTTATCTACGCTCCAACT Right flanking sequence: CAGTTTGCATGGATTCACTCATACTGGgtaagtctg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAATCCATGCAAACTGAGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8175 Y55B1BR.1(sy1201) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8177 npr-23(sy1203) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-23. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGCTTCACCAACTTGATCGCGTTGCTCGTATTGG; right flanking sequence: TGCCGGTGATCATTCATAACGTGTTCACCGGTGTC. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGCGTTGCTCGTATTGGTGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8179 pals-14(sy1205) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-14; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: TTAAATCCAGTTTAGCAGAGAGAAAAGCGGCAGAG Right flanking sequence: GAGAGGCACAACAAAGCGgtatgatcatgcttacc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAGAAAAGCGGCAGAGGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8181 pals-16(sy1207) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAATCATTGACAAATTGCAGAACATCAACACCTT Right flanking sequence: Ggtaggttgaagaagttattattggaatttgaaat inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGAACATCAACACCTTGGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8185 H39E23.3(sy1210) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of H39E23.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGGTCACTGTTCAAGGATTCCCTACAAAAGATC Right flanking sequence: GTGAGGCCAGAGAGACTGAACCAGTGAAACTGCCAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTCCCTACAAAAGATCGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8189 nlp-76(sy1214) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-76; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagTGTTCATCGCAATCTGCGTGCTCTCCCAAAA Right flanking sequence: CGCTATGGCCCTCCGTGGTGCACTATTCCGTTCTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CACGGAGGGCCATAGCGTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8191 nlp-77(sy1216) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-77; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACCAGCCGGAGGTCAAGATGTTCCACCATTC Right flanking sequence: CTTCGTAATGCCACTCCAGCTCAACTTCAGAGCTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8201 oac-2(sy1218) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aattgtggaatttttagATTTCGAAGAATCCTCCC Right flanking sequence: GCTGTACTACTTGACCATCTTCCTCATAGTAGTCATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8203 affl-2(sy975) Y55B1BR.1(sy1220) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1 into sup-45 mutant (sy975); Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. affl-2 formerly known as sup-45.
PS8205 Y62F5A.10(sy1222) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y62F5A.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGAAGAAGATAACACGGAAGGAGAAATCCAACA Right flanking sequence: CCGCACTGAACAAAACAGCATCCAACGACGATCTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTTTTGTTCAGTGCGGTGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8207 F44E5.3(sy1224) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F44E5.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTAGAAAGACTATATGCCATAGTAGAAGATCCGCTC. Right flanking sequence: AGTGAGTTCGTTGCAGGCGGACTACGTTgtaagtttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CCTGCAACGAACTCACTGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8219 Y69A2AR.19(sy1226) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y69A2AR.19; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagAAAAAATCAACGACAATCACCTGGACAGCCCCC Right flanking sequence: GCTCGGATGGACACGAACTAATGGAAAACCCCTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCACCTGGACAGCCCCCGCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8221 pals-26(sy1228) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-26. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTGCTCAAGACATGCGAAATAACATGCAACCTGAA right flanking sequence: CGTGAGCGCCGGCAAAGGGAGCTTGAAGCTTTAG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTTGCCGGCGCTCACGTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8223 Y39C12A.9(sy1230) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y39C12A.9; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCATATATGAATTCAATGGCAAAAGTAGACCCGAA Right flanking sequence: TGATCCATACGTGTTTAAAAAGGATTTAGgtacgtg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAAACACGTATGGATCATTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8225 F52G2.3(sy1232) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F52G2.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCAAATTGACGGTGTCTGCTTCATAAGTCCTGAG Right flanking sequence: TGCGGAACCATAGTTATCGAACCGCCGGCTCCGG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATAACTATGGTTCCGCACTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8234 srw-54(sy1234) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-54; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: TTTGGTACGATCTGCAAAACATCATCAGGCCTATT Right flanking sequence: GATGTGTACTTGGATTACTTCAACTTTTCAATATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAATCCAAGTACACATCAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8240 srw-43(sy1240) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-43; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cactttccaatatttcagCATACCTCCCCTGTCCT Right flanking sequence: ATCTGGAAATGTATTTTATCCAATTATTCAATTCC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATACCTCCCCTGTCCTATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8250 oac-24(sy1246) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-24; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaaaatttcagATTCTTTGTCATTTCCGGATACC Right flanking sequence: TCATGGCGAAAAATTTAACGAAGACTAAACTTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTCATTTCCGGATACCTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8252 srw-36(sy1248) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGACTGTTAACCAATTTCTGATAGGTATCGTAGT Right flanking sequence: TTGTGGGATTATCCACAATGTATGTAGTATCATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGATAGGTATCGTAGTTTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8263 srz-103(sy1254) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srz-103; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGATTAATTGTAGCGTATATTCTCATATGTCGTA Right flanking sequence: ATCTGGATGTTCTTCAAAGATTGCCAATTGTATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TATTCTCATATGTCGTAATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8265 oac-38(sy1256) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-38; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTAGGATTTCACTTCCTGCCAGATGTATTTCC Right flanking sequence: TAATGGATACTTAGGAGTTGATCAgtaagttttcaac inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGCCAGATGTATTTCCTAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8301 oac-40(sy1258) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-40; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTACCAAATTTCTTATGGGAAACTAATAACCGGTA Right flanking sequence: TTCGTTGGCTTCATTATTTTTAGTCACAAATCAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATAATGAAGCCAACGAATAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8303 oac-59(sy1260) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-59; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCACCGTCTTCAAAACGGCTGGACCTTCAAGGCAT. Right flanking sequence: TAGAGGGTTGGCAATTCTATCAGTTCTGGGATTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGACCTTCAAGGCATTAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8305 nlp-78(sy1262) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-78; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGCTTTCTCAAACATCTGTAGTGCGTATCCAGAT Right flanking sequence: TATCGACTTCCTGAAAGAgtaagttttgagaatttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTTCAGGAAGTCGATAATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8307 nlp-80(sy1264) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-80; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCTCTTGTGTATTCTGTTTGCTTTATCCGAAG Right flanking sequence: CTTACAGTCGCATGGAGTTGGAgtaagttaagaac inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCATGCGACTGTAAGCTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8311 nlp-82(sy1266) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-82; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cattttccaactataaattttacagATGCCGTCA Right flanking sequence: TACCACACTGTAATCATCATCCTGCTCATCTCAAT inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATGATTACAGTGTGGTATGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8313 nlp-79(sy1268) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-79; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaattaaattcaacttttcaggtaaaATGTCCACT Right flanking sequence: CGGTGGTTTGTGTTCGTCGCCCTGATGGCTCTCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGGTAAAATGTCCACTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8315 npr-29(sy1270) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-29. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaATGGACTTTACGGAAAATGAAGAGGAGTACGAG right flanking sequence: CATTGGACACATATTGAACGACGAGTCCCGTTTC Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGAAGAGGAGTACGAGCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8317 npr-33(sy1272) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-33. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAACGAGCACATTGATAAGTGTACTGGCCACCC right flanking sequence: AATCAGCTCCGCTTCAATGCTTTTCCTGTCATCCG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGAAGCGGAGCTGATTGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8330 frpr-5(sy1274) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-5. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: gATGAAAATGCAGATCTCCTCGCGTACACCAAAA right flanking sequence: CGTTGGCTTGCCGAGGTGAACATTGTAGATGTTG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCTCGGCAAGCCAACGTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8334 frpr-11(sy1278) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-11. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAACTGCTTCCTCATCTTTAAACTCACACAGTTATG right flanking sequence: ATATGGTTGAAGTGTTTGCTATGATTATGTTGCC Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACTCACACAGTTATGATA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8365 oac-8(sy1284) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTCGCGTTTCACTTTTTCCCTAAAACCTTCCCAAAT Right flanking sequence: GGGTATATTGGAGTAGATATgtaggttgaaataaa inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCTACTCCAATATACCCATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8367 oac-22(sy1286) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-22; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACGCGTTACTTTTTGTGTCAAACAGACCAAAAA Right flanking sequence: CTGTGGCAGAGGACTATTTTACAATGgtaggtgctg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTCAAACAGACCAAAAACTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8369 oac-34(sy1288) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-34; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gCTTCTTTGTGATCTCCGGTTACCTGATGGCCCGTA. Right flanking sequence: ACCTGACACACATGAAAATCTCCAAAATCAGTGAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTTCATGTGTGTCAGGTTAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8394 oac-52(sy1290) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-52; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCAAGGTATTCGAGGTCTTGCTATTACAGTTGT Right flanking sequence: ACTAGGTTTTCATTTCTATCCAGAAGCTTTTCCC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTGCTATTACAGTTGTACT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8396 frpr-1(sy1292) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAAACAAGGCAGGTTGTCAAGGAATACGAACAGTTCA right flanking sequence: ATCTGgtgagttaaaacttcaatttagtgctatg Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAATACGAACAGTTCAATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8398 frpr-9(sy1294) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-9. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCCATCAGTATTCAATGATATTCAGGCAACCATTC right flanking sequence: GATTATTCGGAGgtattataaaattctgtttattt inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATACCTCCGAATAATCGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8400 frpr-7(sy1296) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-7. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTCGCCGTCGACCACCTTCATTGCCTTCATCTTT right flanking sequence: GACTGGGCCCTATACTTCATCCAAATGTTGTCGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCATTGCCTTCATCTTTGAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8426 frpr-13(sy1298) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-13. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: aaaaaatgatgacgctttgatttcagACACCCTTC right flanking sequence: GCAAGAACAGGACAATTCTACGAAAATCGCTCGAT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTGTCCTGTTCTTGCGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8428 frpr-14(sy1300) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-14. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGATATTTTGCAATTCCTGTTTGGGATCCACAG right flanking sequence: ATCCAGAATATTTGgtgagtttaggcttaggcttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACCAAATATTCTGGATCTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8430 frpr-17(sy1302) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-17. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCAGTTAATCAGTCATGATATTATCGATCCAAGCT right flanking sequence: CAGTGGGATTTCAAAACTGTGAACCTTTGgtgag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTATCGATCCAAGCTCAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8432 frpr-19(sy1304) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-19. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATGATTGGCTCAACAGAGGTGCCGTTGTTTGAGG right flanking sequence: AGGAGGATATGTGTACACCACTCAACATTTCTTGTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTGCCGTTGTTTGAGGAGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8434 syIs598. C. elegans syIs598 [F53F1.4p::dYFP + odr-1p::GFP]. Dauer decision marker that indicates commitment to reproductive (continuous) development in hypodermis; low expression in dauers. Transgene carries destabilized YFP (dYFP), which contains YFP with PEST destabilization sequence. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8435 syIs602. C. elegans syIs602 [F53F1.4p::dYFP + odr-1p::GFP]. Dauer decision marker that indicates commitment to reproductive (continuous) development in hypodermis. Transgene carries destabilized YFP (dYFP), which contains YFP with PEST destabilization sequence. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8436 syIs603. C. elegans syIs603 [F53F1.4p::dYFP + odr-1p::GFP]. Dauer decision marker that indicates commitment to reproductive (continuous) development in hypodermis; low expression in dauers. Transgene carries destabilized YFP (dYFP), which contains YFP with PEST destabilization sequence. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8437 syIs599. C. elegans syIs599 [nhr-246p::GFP + unc-122p::RFP]. Pick RFP+ (coelomocytes) to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8438 syIs600. C. elegans syIs600 [col-183p::mCherry + odr-1p::GFP]. Dauer decision marker that indicates commitment to dauer formation in the hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8441 daf-2 (e1370) III; glo-1(sy1306) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8442 npr-26(sy1307) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-26. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGCCCGATGGGATTTTGTATTGTCCAAATCACAC right flanking sequence: TGGTGGTCCCGTCTGGGTACGCAATGTCTATCCAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTGTCCAAATCACACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8444 npr-21(sy1309) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTGTATCCTACCTTTTTGTCTTTCTGGCCACTAT right flanking sequence: AATCGgtatgccaaggatctttgttcatattttta inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCTTTCTGGCCACTATAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8450 npr-27(sy1315) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-27. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gggtgtgccttcttgATGGAGGATTTTTCCTCGA right flanking sequence: ATTTCACGACAACTTCAATTCAGAATGATAGTTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAAGTTGTCGTGAAATTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8457 syIs601. C. elegans syIs601 [ets-10p::GFP + ofm-1p::RFP]. Dauer decision marker that indicates commitment to dauer formation in neurons and intestine. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8482 oac-51(sy1358) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-51; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTACTAGGTTTTCATTTCTACCCAGAAGTATTTCCA Right flanking sequence: AATGGGTATCTTGGAGTTGATCAgtaagttttttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACCCAGAAGTATTTCCAAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8484 npr-31(sy1360) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-31. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaaaaactagttataaaaatgttcagATCCCTTA right flanking sequence: TGTCCAGAAGCTCCCCTTCAGATCGATTACGTGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGGGGAGCTTCTGGACATAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8486 frpr-8(sy1362) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTATTTCGCTTCTTAATAATTCTACACTGGTCA right flanking sequence: CTACGGATCAGCCAGGTTTTTCTGGAAGTACAAAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAATTCTACACTGGTCACTA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8488 frpr-2(sy1364) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTATGCGTGAGTGTGAATGCCTTCATGAGCCGATA right flanking sequence: GAGGGGTACGCGGGAGTTGCCAATCTGgtaagtatac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTCCCGCGTACCCCTCTAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8490 frpr-16(sy1366) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-16. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cacattATGAATCGGTACGAGTTCTACGAGCTAAAA right flanking sequence: TCATGGATGTATTTACCTGTAATTTTCATTGGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGTTCTACGAGCTAAAATCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8527 oac-56(sy1372) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-56; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTTTACTATTTCACTTGAACCCTAACCTATT Right flanking sequence: TGTTAATGGATTTCTCGGTGTTGATATgtaagccc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctag. sgRNA : CGAGAAATCCATTAACAAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8529 oac-57(sy1374) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-57; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGATATCATTTGCATTCAATTTTATTCTTCCATCT Right flanking sequence: AAAGTCTCTTTTAACAGTTTGCTTGCAAGAATATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTTAAAAGAGACTTTAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8531 oac-58(sy1376) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-58. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGATCTCATTCACATTCTATTCAATTCTCCCACT right flanking sequence: TGAAGTGGCTTTTAACAGTTTATTTGCAAGAATATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTAAAAGCCACTTCAAGT Method Reference: G3 (Bethesda).
PS8536 oac-51(sy1388) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatttaataatttaggcATGGTAGTTTACACCGCT right flanking sequence: CTGTGGAACATTGAAGATCAAAATAAGCAATTTAAAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGTAGTTTACACCGCTCTG Method Reference: G3 (Bethesda).
PS8538 oac-35(sy1390) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-35. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTTCTAATGTGCATGTTGCTCAAGCGTGCCGAGA right flanking sequence: CCCACCCATTTTTCACGTTGTTATGCACATTTTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGTGAAAAATGGGTGGGTCT Method Reference: G3 (Bethesda).
PS8540 dod-17(sy1392) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-17. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTAATTGATGGTACGCCTGTATATTGGCCAGCT right flanking sequence: GCTTGGAACGAGACTCAGCCTGCTCCTCAGCTGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAGTCTCGTTCCAAGCAGC Method Reference: G3 (Bethesda).
PS8542 acs-10(sy1394) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of acs-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTCTGGACTCATGTCGTATCCATGCAGCCGCCA right flanking sequence: ATAAGGACGCCATAGTTTTTgtgagtacggatttatc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTATGGCGTCCTTATTGG Method Reference: G3 (Bethesda).
PS8544 clec-87(sy1396) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-87. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTTTTGCCTTCTCGTTGCTTTCATCCTTCCTGGG right flanking sequence: CTATTCCTCGTTCATGCAGCTCCGACTTCTTCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCATGAACGAGGAATAGCCC Method Reference: G3 (Bethesda).
PS8578 clec-88(sy1409) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: TTGGTATGTGCAGTTACTAACGATATTGAAGACGC right flanking sequence: TAGTGGAGAGACACCTGGAATTGTTTCTCAAATTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGATATTGAAGACGCTAG Method Reference: G3 (Bethesda).
PS8580 oac-36(sy1411) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-36. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATGTGCATGTTGCTCAAGCGTGCCGAGACCAAGC right flanking sequence: CATTTTTCACAGTGGTATGCACATTTTACACGAGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCACTGTGAAAAATGGCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8582 oac-41(sy1413) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-41. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATTTTAATATTAGTACACGTTTTTCTACCGGAT right flanking sequence: TTCCTGTGGCAAAATAATAATAGATACTCTTTCGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTATTTTGCCACAGGAAATC Method Reference: G3 (Bethesda).
PS8584 clec-91(sy1415) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-91. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGACCTACATCCTTATCATCGTCCCACTGATCAT right flanking sequence: CATTGGAGGCGGTGTCGTCGCTGACAACACAAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCGTCCCACTGATCATCAT Method Reference: G3 (Bethesda).
PS8586 npr-9(sy1417) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-9. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCATCATTGCCTCTTCAGTAAATACACGTTCACC right flanking sequence: CATAGgtgtataattgaacttatgtatatgttttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAAATACACGTTCACCCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8630 oac-44(sy1431) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTCGGATTCCACTTCTACCCAAACCAGTTTCC right flanking sequence: CAATGGATACCTCGGAGTGGATCAgttaggtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCCAAACCAGTTTCCCAA Method Reference: G3 (Bethesda).
PS8632 oac-42(sy1433) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-42. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTGACTTACAAGGAATTCGGGGTCTCGCCATTG right flanking sequence: CTGCAGTGCTTCTTTATCACTTTTATCCAAAACAA inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATAAAGAAGCACTGCAGCAA Method Reference: G3 (Bethesda).
PS8634 col-135(sy1435) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-135. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCAGCGCTCGGGTATAATATTCGATATCCCTCCT right flanking sequence: ATGAACCAAATCGACAATATGGCCCATATTCGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTCGATTTGGTTCATAGG Method Reference: G3 (Bethesda).
PS8636 ins-10(sy1437) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAAAAACAATTCTTCTAATCTCATTCTTGCTCCTCGT right flanking sequence: AACATTGGCTCCCAGAACAAGTGCAGCTTTTCCATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGGGAGCCAATGTTACG Method Reference: G3 (Bethesda).
PS8674 nlp-6(sy1449) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCGACTCGCCTTCGTTCTTCTCGTCTCGGCGTGCG right flanking sequence: TCATGGCAATGGCTGCTCCAAAACAAATGGTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCTCGTCTCGGCGTGCGTCA Method Reference: G3 (Bethesda).
PS8676 nlp-9(sy1451) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-9. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gaaaaaaagagagATGGATCGATTCGCCACCAGAT right flanking sequence: TTATCGCCCTTCTTCTGGTTCTTTTACAAATTGgtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGAAGAAGGGCGATAAATC Method Reference: G3 (Bethesda).
PS8678 nlp-13(sy1453) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGATCTCTTCAGATCTTCTGCATCATGTCCGCCA right flanking sequence: TCGCAATGGCATACAGTCAAGgtttgtgttgtgtc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTGTATGCCATTGCGATGG Method Reference: G3 (Bethesda).
PS8680 nlp-16(sy1455) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-16. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTTTCCCCATTGGAAAAGACAATGAATCCGACG right flanking sequence: AGTCCGAAGTTGAAGTGGATACCACAACTGAAGCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTTCAACTTCGGACTCGT Method Reference: G3 (Bethesda).
PS8682 nlp-19(sy1457) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ctctactgttgtatattcttcttcacaATGCTCTT right flanking sequence: ACGCGGTGTATGCCTTGCTCTTCTCATTCTAGTCAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTTCACAATGCTCTTACG Method Reference: G3 (Bethesda).
PS8687 nlp-32(sy1459) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-32. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTACTTGTATTCTGTCTTATCGCATTGACCGCCT right flanking sequence: TGCCGGTTTTCTCTTTTCCAAATGGGCTAACTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGAGAAAACCGGCAAGG Method Reference: G3 (Bethesda).
PS8689 nlp-33(sy1461) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-33. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTCTCTTTGCCATATTGGCTATCGTTGATGCCCA right flanking sequence: GTGGGGATgtaagttttcaataacttgtttctg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCTATCGTTGATGCCCAGTG Method Reference: G3 (Bethesda).
PS8691 nlp-43(sy1463) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gctcggaagtATGTCGTTGGCTCAATCTACCTTCT right flanking sequence: ACCTTCTATTTGTTGCATTTTTGGCAGTTGTGATC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACAAATAGAAGGTAGA Method Reference: G3 (Bethesda).
PS8693 nlp-73(sy1465) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-73. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGCTCATCGCGACCACTGTGCTCATCGCCGAGT right flanking sequence: CTCGTGTATTCTATAACCGATTCGACGGCGGGCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATAGAATACACGAGACT Method Reference: G3 (Bethesda).
PS8695 lgc-16(sy1467) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCACATTATTTTCATTTTCTGACATTTCCGCAT Right flanking sequence: TTTATCATGATCCAGGATTATATGgtaaagtttgg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCTGGATCATGATAAAATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8697 lgc-18(sy1469) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-18. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gtttttattcaaaatgttaattcttcattttgcagTTCCG right flanking sequence: GAATGGAACAATTTCTTGGAGAATCAAGTTAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCATTTTGCAGTTCCGGAA Method Reference: G3 (Bethesda).
PS8702 lgc-19(sy1472) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCGATTCTTTTTTCTTTGATCCAGAGTTATAC right flanking sequence: Ggtaggctattttggctttcaggctcaaaaaaggtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGATCCAGAGTTATACGGT Method Reference: G3 (Bethesda).
PS8704 lgc-1(sy1474) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagTGGCAACCTACAACAAATTTCTCGCCGATCAA right flanking sequence: AAACGGCTTTGGGATGATTTATTCAAAGATTATGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTTCTCGCCGATCAAAAA Method Reference: G3 (Bethesda).
PS8705 lgc-24(sy1475) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-24. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGTCACAATGGGAAACGGGAAAAAGCTTCACGG right flanking sequence: TTTTGgtgagttttatttttcatatgttgattattag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGGAAAAAGCTTCACGGTTT Method Reference: G3 (Bethesda).
PS8707 lgc-21(sy1477) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-21. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGCATTTGCTCTAGGCCAAGAGCAGAACCAAGC right flanking sequence: CGGTACCGCGGTTGCCGGGCCCCATATCGTCAACTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGGCAACCGCGGTACCGGCT Method Reference: G3 (Bethesda).
PS8708 lgc-22(sy1478) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-22. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCTTCTCATTGCCACGTCACTGGCCGCCACGTTA right flanking sequence: GCGTGGGCGGCGGGCACCGCCGGCGGCTGCGAGGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTGGCCGCCACGTTAGCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8710 lgc-25(sy1480) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-25. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cggtttcaagGGATTCTGGTAATCTGGCACCTGGA right flanking sequence: TAATCAAGTGTGTGGTCTTTCAAAAGAGCAACAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACCACACACTTGATTATCC Method Reference: G3 (Bethesda).
PS8711 lgc-29(sy1481) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-29. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATATATTCGCTTTTATTTTATTTAATGGTCCCTCTC right flanking sequence: TGGAGCACTGATTCACAGAGCATGACGTCAGAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGAATCAGTGCTCCAGAG Method Reference: G3 (Bethesda).
PS8713 lgc-32(sy1483) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-32. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTGCACAAGTGATGAAGATGTGATTGCTGATCT right flanking sequence: CTTAGGAAGAAATTCACATTCTTCTGgtaacttattg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GATGTGATTGCTGATCTCTT Method Reference: G3 (Bethesda).
PS8721 lgc-30(sy1486) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-30. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTCATCCCGAAAAAACTAATAAAAAAGCCGCCG right flanking sequence: GCTATCGACGACACGGCGTTTCATCGGCGTCGAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCGTGTCGTCGATAGCCGG Method Reference: G3 (Bethesda).
PS8723 lgc-27(sy1488) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-27. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACACTTTCAGTTGCCGCTTATGATATCGATTGC right flanking sequence: AAATGGAAAAGCAATATTACAGgttggtgctcaaac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTATGATATCGATTGCAAA Method Reference: G3 (Bethesda).
PS8725 lgc-28(sy1490) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-28. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGCTTAAATATTCAACTGGAACCTTCTCCTGGCG right flanking sequence: AGATGGAGAAAAGATATGAAGCTGAGgtatgtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAACCTTCTCCTGGCGAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8727 lgc-37(sy1492) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-37. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATAATTCCCATCATTGCTCTAATCCATGGACATCATT right flanking sequence: CTCAGGCTGTCATAGACATGAAGAGACAACGgtaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATCCATGGACATCATTCTC Method Reference: G3 (Bethesda).
PS8729 lgc-41(sy1494) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-41. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCGGCCACCAACAGCAAATGCATCAGTACCACTC right flanking sequence: GGTGTCAAACTTGGAATGTATTTGGAGAGTCTCGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCCAAGTTTGACACCGAG Method Reference: G3 (Bethesda).
PS8731 lgc-43(sy1496) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cttctaattttcagAAGTTTTAACAACCGAAG right flanking sequence: CGTCAACTGATTCTTCTTCTCCAACATCGAGCATATTTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGAAGAATCAGTTGACGCTT Method Reference: G3 (Bethesda).
PS8741 lgc-44(sy1500) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTATTTCTCTTCTTTTTCTAATATTTCCACAT right flanking sequence: TCATCTAATCCTTCAAGCTCTAATTTTCTGGATATTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTGAAGGATTAGATGAATG Method Reference: G3 (Bethesda).
PS8742 lgc-47(sy1501) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-47. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCCACATTGTTTCTGTTGCTCTATGCCACCCGGG right flanking sequence: AAACGGTCAATGCAATGACTGCCGAGATCAGCCC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATTGCATTGACCGTTTCCC Method Reference: G3 (Bethesda).
PS8743 lgc-36(sy1502) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-36. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGGAAGTTTTCGTATAAAACGAACTGTTCACCCT right flanking sequence: AAAAGgtaagtaaccatctaattcaactattttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGAACTGTTCACCCTAAA Method Reference: G3 (Bethesda).
PS8745 lgc-7(sy1504) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-7. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTCTTATTATCAATATTTCAATGAATACCATGT right flanking sequence: CTGTTCTAACACTAGATCCTGCTGAAGAAACCATC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCTAGTGTTAGAACAGACA Method Reference: G3 (Bethesda).
PS8747 lgc-48(sy1506) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-48. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagcttcATGTTTTTTCATATTTTTTTGGGCCTACT right flanking sequence: GGTCGCTGTTTTGGGTGAAGAAGTTCATGAACTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACCCAAAACAGCGACCAGT Method Reference: G3 (Bethesda).
PS8749 lgc-8(sy1508) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGTATCAGAGCAGTTGAAGGATGTTCTTATGGAA right flanking sequence: Ggttggtattgatttagttcaccaaaaagagtttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGGATGTTCTTATGGAAGGT Method Reference: G3 (Bethesda).
PS8751 otpl-1(sy1510) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCACTGTTCTTAACCATTTTCTCACTGGTACTCG right flanking sequence: AGCTGGCTCACTTGCTCAATGATGAGGAATCCCGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTCACTGGTACTCGAGC Method Reference: G3 (Bethesda).
PS8779 col-88(sy1512) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCCTTATCGGTACCCAGGTGATCCTCTCCACCG right flanking sequence: CTATCCTTGGCTCCCTGCTCTACGCCGGTGTCCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGGGAGCCAAGGATAGCGG Method Reference: G3 (Bethesda).
PS8785 ZK637.2(sy1518) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZK637.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGATGAGATGATTGACGATTTGGATAAGACCTATT right flanking sequence: TGAGGGATATGCAGAAGAGCATGTTTCAGTGCTCAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTCTGCATATCCCTCAAAT Method Reference: G3 (Bethesda).
PS8787 col-81(sy1520) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-81. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaatatccctctcaattccagCATCGCCGCCGCTC right flanking sequence: TCATCGCTGTCATCGCCATCCCAGCCTTCTACAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGCGATGACAGCGATGAGAG Method Reference: G3 (Bethesda).
PS8789 dmsr-1(sy1522) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTATACATGCCTACTTATCAATATTTCTATGCGT right flanking sequence: GTTGGGTACAATCGCTAATTTCTGTAACATCGTCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCAATATTTCTATGCGTGTT Method Reference: G3 (Bethesda).
PS8819 col-120(sy1526) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-120. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTCTGGAATCATGTGCATTATTCTAATTCCTGGG right flanking sequence: CTTTACACATATCTACAATATATTCAAAGCTCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTAGATATGTGTAAAGCCC Method Reference: G3 (Bethesda).
PS8821 col-129(sy1528) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-129. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ccgtctggcaccaaatgATGACTGTTGTCCCACA right flanking sequence: AGGAGGCAAGCAACGTCAAGTCTACGAGTCCCTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGACTGTTGTCCCACAAGG Method Reference: G3 (Bethesda).
PS8822 col-137(sy1529) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-137. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATCGCAATTTCCACGATTGCAACTCTGACCGCTA right flanking sequence: TCTTGGCAATTCCAATGTTGTACAATTACATGCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACTCTGACCGCTATCT Method Reference: G3 (Bethesda).
PS8823 dmsr-6(sy1530) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaatacttactaatttaaaatttttagCCTATA right flanking sequence: CTCTAACGTTCATCCTTTCTTGTCATTCATCCTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGGATGAACGTTAGAGTAT Method Reference: G3 (Bethesda).
PS8825 clec-47(sy1532) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-47. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCATTTTTGTACTTGCAATTTTTATATTTCCAATT right flanking sequence: GCTTCAATTTCGTGTCCAAGTGGCTTTACACTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGACACGAAATTGAAGCAAT Method Reference: G3 (Bethesda).
PS8827 col-139(sy1534) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-139; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTTACCGATTCATTGCCTACTCGGCAGTTACAC Right flanking sequence: TTTCGGTTGCTGCAGTTTTTGGGgtaagtttcagc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTACTCGGCAGTTACACTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8829 col-156(sy1536) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-156; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGAACACGTTCATCGCTGGACTCACCACTGT Right flanking sequence: ATCCGGTGTAGCGATTCTCGGATGTCTTTTGTTTTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTGGACTCACCACTGTATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8854 dmsr-7(sy1539) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-7; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTCAGTTGTTTGATCCGAACAGTAACAGTA Right flanking sequence: CGCAGGCATTTCTTCGGAAACTTGCACATTTTCAAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGAACAGTAACAGTACGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8856 dmsr-8(sy1541) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATATTCATCCGTACGTCTCTGTGATTCTCTGTCT Right flanking sequence: TGCAGgttggttattatgaagtgatcgcacatgttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCTGTGATTCTCTGTCTTGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8858 dmsr-3(sy1543) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACGGTATTCGAGACGTTTCTCCTCGAATAT Right flanking sequence: GGGAGGATAATTCACCCGCCGATGGTCCTACTTTTATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGTTTCTCCTCGAATATGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8860 dmsr-4(sy1545) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGGAACACTGTTCGACCCGCAGGATCCCGCAG Right flanking sequence: TTTCTGGCCTCATCGATGCTCTCGAGCAATTTCAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATCGATGAGGCCAGAAACTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8861 dmsr-9(sy1546) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-9; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATATTTTAGCCAATATCCGGAAGCCAATAGTG Right flanking sequence: ACGAGGCAAAAGATTTGTTTATTACTTCATTGATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGGAAGCCAATAGTGACG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8863 dmsr-10(sy1548) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCAGTGGCCAGATCCAGAAACTGGAGATGCTAAGG Right flanking sequence: ACTTGGTTATTTCTCAATTTATTAATACAGTTGTAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AACTGGAGATGCTAAGGACT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8865 lgc-42(sy1550) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-42; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAATGGAAATCCGAAGGCTCCGCTGCAAGTGCA Right flanking sequence: CTTTGGTTTTTATGTGGAGAGCTTGGGAAATTTCAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCCGCTGCAAGTGCACTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8882 dmsr-11(sy1551) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-11; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTGAGGCTGCAATTAATAACGGAATTGTTTCCTTCA Right flanking sequence: TGGACGCATTAGTAAAgtaatttaaactttagc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTTACTAATGCGTCCATGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8884 dmsr-14(sy1553) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-14; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGTTTATTGCTGTTAGTGATTTCGGATGTGCAGT Right flanking sequence: TACTGGTTTGATGCAATTATTTATAAGAAATTATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GATTTCGGATGTGCAGTTAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8886 gnrr-1(sy1555) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gnrr-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCAATGATTCTGTTCTATCAATTGTCTTCACAT Right flanking sequence: ATTTGGCTTTATTTATTCTGGCATTTGTTGGAAATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATCAATTGTCTTCACATATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8888 dmsr-5(sy1557) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttgaaaaaaatggttgcagGGTCTACACAGTATTG Right flanking sequence: CATCGGTATTTATGTCTTTTTGTGTGTTTTTTCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGGTCTACACAGTATTGCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8890 dmsr-12(sy1559) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-12; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGCCGTTTCACTACTATATATTCACTTCCTTAG Right flanking sequence: TTGTTTTGCATTTTTTGCAAATATTATGATTGTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAAAAAATGCAAAACAACTA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8892 dmsr-13(sy1561) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-13; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACTGTGCCATATCCGGAGCCGGGCACCGATGAA Right flanking sequence: GTTGGGAATAGCACGATTCCATGGTTGATTACTAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGCCGGGCACCGATGAAGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8894 dmsr-15(sy1563) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-15; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: AAAAAACATGTCAGAAAATAAAAATCGCGGAGATA Right flanking sequence: TTTCGGATTGTCAACAAAATTTGCTCGATTCAAATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAAAAATCGCGGAGATATTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8896 dmsr-16(sy1565) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTAAGTTTCTTTGCAAATGCTCTTATCGCTATAG Right flanking sequence: TTCTGGCAAACAAGGTTATGAGGATTTCTGGAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGCTCTTATCGCTATAGTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8897 oac-21(sy1566) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACAAAAATCTTCAAAACGACTAGATCTTCAAGGC right flanking sequence: ATCCGGGCTCTCGCTATTCTAGTTGTTCTTGGCTTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACTAGATCTTCAAGGCATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8900 sprr-2(sy1569) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of sprr-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGTTTATTGCGGCAATGCGCATGCAGAGCCAAAT Right flanking sequence: AGCTCAGCAGTTCAACAACTTGCAGAAGCATGTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTTGAACTGCTGAGCTATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8902 npr-6(sy1571) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-6. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gtaatttttattttaaaaaaacacgtttcagAACC right flanking sequence: CCATGGAAATGGAATATTTCCGCCCATTCTTTATTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACACGTTTCAGAACCCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8934 oac-30(sy1577) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-30; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattttgaaacttgctgaaattttcagATTCCGCCG Right flanking sequence: AATCCTGCCACTCTACTATCTCCTCATCTTCTTAA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGTAGAGTGGCAGGATTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8936 otpl-2(sy1579) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATGAAAATATGAAACGTTGGACGAAAAACCCGGAA Right flanking sequence: GCAAGgtaaaaagggaataactcaatataattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGACGAAAAACCCGGAAGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8938 frpr-12(sy1581) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-12. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTTTCCAACTTCTAATGTTCAAAGTTACACCTTGA right flanking sequence: ATGAAGTGTTTTCAATGGTTATGCTACCAATTATT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATTGAAAACACTTCATTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8940 otpl-3(sy1583) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCGTCAAATTGTTCTACAATTGCAACACCCAAC Right flanking sequence: AGCAAAGTCAGATTTCGGTATCATGAGAAACGATATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAAATCTGACTTTGCTGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8942 otpl-4(sy1585) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-4 ; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTCAATTGTTTTTTATATTATTCTGGGACTGACA Right flanking sequence: TCGTGGAAAAAGgtgagaatagcaagatttattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTATTCTGGGACTGACATCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8943 otpl-5(sy1586) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGAGCACAAGCACATCGGTAGCAATGTCCACAT Right flanking sequence: CAGACGGGTTCAGTAGCCATGACGATATTTCACAATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTACTGAACCCGTCTGATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8945 otpl-6(sy1588) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-6; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGAATCTACATCCAGCGATGTTACTGTCCTAAC Right flanking sequence: AGACTATAGCAGTACTATTCCAGAAAATCTTCCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAGTACTGCTATAGTCTGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8988 otpl-7(sy1590) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-7; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGTCAGTGTTGCGAGTACATCAACAGCCCCACTT Right flanking sequence: GATCATGTCACAGTTCCAAATGCTCTTCCATCAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAACTGTGACATGATCAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8990 otpl-8(sy1592) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATCACCCACACATCATCATGAACTCTACCGACGA Right flanking sequence: CCTTGGATTCATGAGCCAAGAGCCACgtaagtctag inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATGAACTCTACCGACGACCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8992 msp-3(sy1594) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTGGACCCAAAGGAAGCTGTGCTTCTTGCCGTGT Right flanking sequence: CATGCGATGCCTTCGCCTTCGGACAGGAGGACAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGCGAAGGCATCGCATGACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8997 flp-1(sy1599) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACTCTGCTCTACCAAGTAGGGTTATTACTCCTTGT Right flanking sequence: GGCAGCTACTTATAAGgtttctttcttgatttaat inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CCTTATAAGTAGCTGCCACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9048 msp-40(sy1604) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-40; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACACCCCGGATGGAGCTGCTAAGCAATTCCGCCG Right flanking sequence: TGAGTGGTTCCAAGGAGACGGCATGGTTCGTCGTAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCTTGGAACCACTCACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9050 flp-4(sy1606) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-4. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACGTTGCTTGCACTCACAGCAGCTCATCCACCGTC right flanking sequence: ATCTGGTGAAGAAATTGCTGAGCAAGAAGAGAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCAGCTCATCCACCGTCATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9052 flp-22(sy1608) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-22. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTTTGTGTTGTTTTGATGGTATCATTGGTGTCGG right flanking sequence: CTCAGGTCTTCGATTTGGATGGACAACAGTTGGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTATCATTGGTGTCGGCTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9058 shl-1(sy1614) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of shl-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTTCGAGACAGCCCATGCCACAGGCCCCAGTTGCAA right flanking sequence: TACAGgttaggtttggtgggaataattttctaaat inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGGCCCCAGTTGCAATAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9191 kvs-4(sy1622) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kvs-4. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gttcctaacatgattgttgaaaataattttccagAA right flanking sequence: GCACGGAGGAGGAGCGACGCACAGTGCAGACAGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCGCTCCTCCTCCGTGCTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9192 mgl-1(sy1623) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of mgl-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGCACTTATTCTTGATTCATGCTCAAATCCAGCA right flanking sequence: TATGCGCTAAACCAGAGTTTAGATTTTGTGAGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTCTGGTTTAGCGCATATGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9195 col-46(sy1626) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-46. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCGTTTATTGTTTCTGTAGGACCCCTTGCCTCAA right flanking sequence: TACTTCGACCGGCTATTCAGAATACTGTCAACGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATAGCCGGTCGAAGTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9197 col-40(sy1628) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-40. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: aactattttcagGTCGAATTCTGCAAGCACCGAAC right flanking sequence: TGACGGACTCTGGGATGAGTTCCACAGAgtaagta inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGCAAGCACCGAACTGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9199 col-54(sy1630) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-54. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTCTTCTTGTTGCTGGATCATTATTCTTTGAAGC right flanking sequence: TCAAGGATTTTTAGAGACTTCACTTGATGAAATTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCATTATTCTTTGAAGCTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9201 col-133(sy1632) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-133. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGCAAGCACTCTGCTCGTGACATTTTCGCCGAGG right flanking sequence: TAAACCACATCCGTTCTTCACCAAAGAACGCTTCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGAACGGATGTGGTTTACCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9355 col-102(sy1735) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-102. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATGAGGTCTCTCAAGATCTTACACAATTCCGTGG right flanking sequence: ATACTATGATGATGCGTGGAGAACCATGATGGTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGCATCATCATAGTATCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9359 col-114(sy1739) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-114. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCAAGCAGCTCATTAATACTGAAGTTGTCTCTT right flanking sequence: AGgtaagattaatgaaccatgtgaataatatg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACTGAAGTTGTCTCTTGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9361 oac-19(sy1741) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-19. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTCTTGCTATAATTGCAGTTCTAGGCTTCCACTT right flanking sequence: CTACCCTGACACCTTCCCAAATGGATATCTTGGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAAGGTGTCAGGGTAGAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9362 oac-45(sy1742) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-45. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTTGGATTTCATTTCTACCCTAATCAGTTTCCC right flanking sequence: AATGGGTACCTTGGAGTTGATCAgtaaggtttttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCCTAATCAGTTTCCCAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9363 col-116(sy1743) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-116. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATTTCCGCAGTTTCAATATTTGGTGCCCTAT right flanking sequence: GTGTGGCAGCTTCAATTTTAGTTGGTATTAACGAA inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATATTTGGTGCCCTATGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9364 col-109(sy1744) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-109. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatcaccttttcccccattcgttttttccagTC right flanking sequence: GACCGCCAGAGATATCATGTCTGAAATCAGTCACAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATATCTCTGGCGGTCGAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9366 srx-12(sy1746) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-12. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCATTGCAAATTTTGGGGTTCTATTTGTATTCTGC right flanking sequence: ACATGGGTCACGCCGACCACTATTATgtaggtttttg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTATTTGTATTCTGCACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9374 sra-14(sy1748) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of sra-14. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCAATCGGGTGTTTTGTTGGAGTTGCCTACT right flanking sequence: GTATAAGGTTTATGCGGAAACACCCGATTTTCAGCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCGCATAAACCTTATACAGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9376 srg-48(sy1750) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-48. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTCTCCAGAACTATTCAATTTCTTCATGTTTTGCG right flanking sequence: GGCTGGCATTTCTTCATCTTCAGTCATGTAGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTTCATGTTTTGCGGGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9378 srv-28(sy1752) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srv-28. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTATACTATGGAATGTCGATTTTAAGTCTTCCCTTATA right flanking sequence: CTTTGGTGTTCTCATTTGTTTGTTGAGATTGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTAAGTCTTCCCTTATACTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9380 kcnl-2(sy1754) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. left flanking sequence: GTGATGTAAACGAAATTCCAAAAACGAATGGAGG right flanking sequence: AGGACATCCAATTGTTAGAAGAAAAAGTGGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCAAAAACGAATGGAGGTCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9381 kcnl-2(sy1755) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: GAATGGAGCAATTGGAGATGATTCAACAGTTCCAT right flanking sequence: TGATGGACGAAAAAGATGATAACAGgttagttattc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATTCAACAGTTCCATTGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9391 syIs802 X. C. briggsae syIs802[Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS9392 syIs803 II. C. briggsae syIs803 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS9393 syIs804 X. C. briggsae syIs804 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS9396 syIs807 IV. C. briggsae syIs807 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS9419 col-131(sy1765) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-131. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTTTCGGTGCTGGTATTTGTCCTTCAGACCAAGA right flanking sequence: ATGATTTGGACCAAGTTTGGGCCGAGTTTGATCAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTTGGTCCAAATCATTCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9421 col-158(sy1767) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-158. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GACCGCCGGGGCTTTGTGCCTCTCCTCGGCCACTC right flanking sequence: TCATCCTCTCGCTTTATGCAATTTTCTCAATTTATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATAAAGCGAGAGGATGAGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9458 srv-8(sy1771) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srv-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTTATTTTGTAGAAATACAAATTTTATTCACT right flanking sequence: TCGAGGAATTCTACTTTCAAAGgtcagagaagata inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACAAATTTTATTCACTTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9460 col-2(sy1773) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTTGTCGCCGTTGTCTCTGTTTTCATCACATTGC right flanking sequence: CAATGGTTTATAACTATGTTAATAATGTGAAGAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTTTCATCACATTGCCAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9464 srg-6(sy1777) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-6. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ATTTCAAAAATGATTTACGTGATACAAGTGAAACA right flanking sequence: TCGAGGTGATTATCATGAACAGAGGCGGTTTTGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGATACAAGTGAAACATCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9466 fbxa-199(sy1779) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of fbxa-199. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGTTTACTATTTTAACTGTTGGCCTGGCAACTTC right flanking sequence: GGACGGCGTGTTTTCAACGCTGTACTTGTTTTACG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTGGCCTGGCAACTTCGGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9467 col-37(sy1780) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-37. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATCCATGTGATGACCGATATTAGCAACTTCCAAG right flanking sequence: ATGAGGTTATCTCCGATTTAAGCAATTTCAAGCAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTAGCAACTTCCAAGATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9469 col-43(sy1782) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-43. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTATGCTGCCGTCTCATTCTCAATTGTGGCCGTTC right flanking sequence: TTTCGGTGGTGCTCACACTACCAATGGTCTACAAT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTCAATTGTGGCCGTTCTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9485 col-36(sy1783) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-36. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTTGCGGTTGCTGTCTCAACTGCAGCCGTCATT right flanking sequence: TCAAGgtaattaaaaacttcactcttcagattatc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAACTGCAGCCGTCATTTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9487 srd-32(sy1785) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srd-32. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACCATATACTGTATTCTTGGCGAACACCTCTA right flanking sequence: TAACGCAGCTAGGGTATTGCATATGTTTCCTCTTAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATACCCTAGCTGCGTTATAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9491 col-45(sy1789) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-45. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGCCGGGACGAGGAGCTCGTGGCCCGAACCAAGC right flanking sequence: GAGCGGTTAAAGGCACATGGCTCTTCGGACAGTAT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGTGGCCCGAACCAAGCGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9494 col-73(sy1792) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-73. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GACCAGATGCTCCAAATGAGCACGTTCAACCAACT right flanking sequence: CCAGCCGATTTCTGCTTCGAGTGCCCACCAGGACC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGCAGAAATCGGCTGGAGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9496 him-5(e1490) V; seb-3(sy1794) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of seb-3 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATTGAAAAAACTGGAAAACAGTTCGTATAATCCG right flanking sequence: GGgtgggtcaagttccagtgttcagtttttttaaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGTTCGTATAATCCGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9502 srsx-40(sy1800) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srsx-40. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTATTTTGACAATCGACAGAATAATTGCCACGT right flanking sequence: GTACACCTATTCAATACAAGAATTTGAAACATTGTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTATTGAATAGGTGTACACG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9504 him-5(e1490) V; str-74(sy1802) X. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of str-74 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGGAATATTGTTTTCGGGAATAGAAATCCTTGC right flanking sequence: CAGACCATTCGCTCATAATTATAACAACAGTTTGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATGAGCGAATGGTCTGGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9506 col-84(sy1804) II. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-84. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatttttaaagcgaatttttctagCAAGAAACCGACG right flanking sequence: CAATGTGGAAGGATTTGGTTCAAATTGGCACCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAATCCTTCCACATTGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9508 kvs-2(sy1806) V. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kvs-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAATTGGTGAATCAAGGAGCACGACGATCACACATGA right flanking sequence: TTCCGgtttgattttcattgaattcgtgggaac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGACGATCACACATGATTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9520 nlp-21(sy1807) III. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaaattgatactatgaaacattatatttccagCG right flanking sequence: CTTGTCATGGTGCTCAACGCCCAATACACTTCCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGAGCACCATGACAAGCGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS968 unc-101(sy216)/hIn1 [unc-54(h1040)] I. C. elegans Heterozygotes are WT and segregate embryonic lethals (sy216 homozygotes) and paralyzed Uncs (h1040 homozygotes). sy216 is a deletion of the unc-101 gene region. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS9711 col-110(sy1737) IV. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-110. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGGTTTTGACGGTTGGAGCAATGGTAACCCTTCC right flanking sequence: ACTAGCCTATCATTATGTTAATCAGTTGAGAAATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATAATGATAGGCTAGTGGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS976 lin-48(sy234) III; him-5(e1490) V. C. elegans Lineage defects in B, F & U blast cells resulting in abnormal spicules and ectopic spicule cells. F34D10.5 rescues lin-48(sy234); it encodes a C2H2 zinc finger protein similar to Drosophila ovo. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS99 dpy-20(e1362) IV. C. elegans Severe Dpy. Cold sensitive: grow at 20C. Can be used for microinjection because rescued animals are easier to pick out than dpy-20(e1282) rescued animals. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS998 goa-1(sy192) I; him-5(e1490) V. C. elegans This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
temp_name67 cog-1(sy607) II. too sick-didn't grow

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
WBVar00249046 SNP substitution
sy294 Allele substitution
sy574 Allele
sy5440 Allele
sy29 Allele substitution
sy97 Allele
sy241 Allele substitution nonsense
sy101sy127 Allele substitution
sy101 Allele substitution
sy127 Allele substitution nonsense
sy441 Allele substitution nonsense
sy96 Allele substitution splice_site
sy254 Allele
sy93 Allele substitution
sy237 Allele substitution nonsense
sy143 Allele substitution nonsense
sy129 Allele substitution
sy263 Allele
sy290 Allele substitution
sy277 Allele deletion
sy15 Allele
sy1 Allele substitution nonsense
sy17 Allele substitution splice_site
sy247 Allele substitution nonsense
sy326 Allele substitution
sy328 Allele
sy327 Allele substitution
sy331 Allele
sy291 Allele
sy275 Allele substitution
sy428 Allele substitution nonsense
sy511 Allele substitution nonsense
sy549 Allele substitution
sy10 Allele
sy552 Allele
sy433 Allele substitution
sy509 Allele
sy582 Allele
sy606 Allele
sy607 Allele deletion
sy576 Allele substitution
sy605 Allele deletion
sy621 Allele substitution
sy628 Allele substitution nonsense
sy622 Allele substitution nonsense
sy557 Allele substitution
sy676 Allele
sy693 Allele deletion
sy665 Allele substitution nonsense
sy100 Allele substitution
sy702 Allele substitution nonsense
sy705 Allele substitution nonsense
sy12 Allele
sy108 Allele insertion
sy99 Allele substitution
sy92 Allele substitution
sy155 Allele
sy161 Allele substitution
sy5341 Allele
sy216 Allele deletion
sy234 Allele substitution
sy192 Allele substitution
sy691 Allele
sy690 Allele
sy695 Allele deletion