Strain Information
| Name | PS7731 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | K03E5.2(sy1082) I. |
| Description | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG Reference: Wang H, et al. G3 (Bethesda). |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Heenam Park |
| Laboratory | PS |
| Reference | G3 (Bethesda). |
Sign in
or
register an account if you want to order this strain.