Strain Information
| Name | PS4997 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | unc-119(e2498) III; syIs179. |
| Description | syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. |
| Mutagen | gamma rays to integrate |
| Outcrossed | x0 |
| Made by | L. Ryan Baugh |
| Laboratory | PS |
Sign in
or
register an account if you want to order this strain.