University of Minnesota Driven to Discover logo

Caenorhabditis Genetics Center (CGC)

    • Sign In

    Strain Information

    Name PS4997   View On Wormbase
    Species C. elegans
    Genotypeunc-119(e2498) III; syIs179.
    DescriptionsyIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC.
    Mutagengamma rays to integrate
    Outcrossedx0
    Made byL. Ryan Baugh
    Laboratory PS
    Sign in or register an account if you want to order this strain.
    • Job Opportunities within the CGC
    • CGC Home
    • Search Strains
    • Register
      (existing labs)
    • Request a Lab Code
      (new labs)
    • Strain List
      • Recently Added Strains
      • Endogenously-tagged Loci
      • Protein depletion strains NEW!
      • Wild Isolates
        (Caenorhabditis sp.)
      • Wild Isolates
        (non-Caenorhabditis sp.)
      • Strain List (text file)
    • Strain Donation
      (Users must be signed in)
    • Request Knockout
      (of Alzheimer's related genes)
    • Lab List
    • Acknowledging the CGC
    • Contact
    • Frequently Asked Questions (FAQs)
    • Conditions Of Use

    • What Is C. elegans?
    • Nomenclature

    • CaeNDR - the Caenorhabditis Natural Diversity Resource
    • WormAtlas
    • WormBase
    • National Bioresource Project for the Experimental Animal
      C. elegans
    • WormBuilder
    • WormBook
    • WormBook in Genetics