Strain Information
| Name | PS4997 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | unc-119(e2498) III; syIs179. |
| Description | syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| Mutagen | gamma rays to integrate |
| Outcrossed | x0 |
| Made by | L. Ryan Baugh |
| Laboratory | PS |
Sign in
or
register an account if you want to order this strain.