Strain Information
| Name | PS9355 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | col-102(sy1735) IV. |
| Description | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-102. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATGAGGTCTCTCAAGATCTTACACAATTCCGTGG right flanking sequence: ATACTATGATGATGCGTGGAGAACCATGATGGTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGCATCATCATAGTATCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Heenam Park |
| Laboratory | PS |
| Reference | n/a |
Sign in
or
register an account if you want to order this strain.