Strain Information
| Name | PS8031 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | cest-1.1(sy1180) V. |
| Description | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of cest-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGGAGACCTTCGATATCGAAAACCCCGTCCACCG Right flanking sequence: AAATCATGGGAAGGAGTTTTGGTAACAAATGAATA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCTTCCCATGATTTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| Mutagen | Crispr/Cas9 |
| Outcrossed | xNo |
| Made by | Heenam Park |
| Laboratory | PS |
Sign in
or
register an account if you want to order this strain.