Strain Information
Name | PS9500 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | ufd-3(sy1798) II. |
Description | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. Left flanking sequence: CAATTTCCCATGTTATTGAAGCCCACAAATCCGACA. Right flanking sequence: CAAAGGCTTTGGCAGTTACTCAAGGCGGATGCTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCCCACAAATCCGACACAA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | Heenam Park |
Laboratory | PS |
Sign in
or
register an account if you want to order this strain.