Strain Information
| Name | PS7898 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | C53C9.2(sy1116 sy1118)/tmC30 [ubc-17(tmIs1243)] X. |
| Description | Superficially wild-type. a weak allele for C53C9.2 ; 58 bp insertion from downstream sequence of its own and 1 bp deletion (leading to change of an animo acid and insertion of 19 amino acids in frame); balanced with FX30326, further confimed by genotyping for homozygotes of C53C9.2 Left flanking sequence ACCGCTGTCGGTATGCCACGTTGGAATATCACCAAG; Right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATCTG; inserted sequence between the two flanking sequence: CTCGGAGAAGACATTCTCCGACGAGGAACCGAATTCACACCATGGTACTCTGGACAAA. sgRNA : GTATCCTTGCTTCTTGTCCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| Mutagen | Crispr/Cas9 |
| Outcrossed | xNo |
| Made by | Heenam Park / Han Wang |
| Laboratory | PS |
Sign in
or
register an account if you want to order this strain.