Strain Information
Name | PS8542 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | acs-10(sy1394) V. |
Description | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of acs-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTCTGGACTCATGTCGTATCCATGCAGCCGCCA right flanking sequence: ATAAGGACGCCATAGTTTTTgtgagtacggatttatc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTATGGCGTCCTTATTGG Method Reference: G3 (Bethesda). |
Mutagen | Crispr/Cas9 |
Outcrossed | xNo |
Made by | Heenam Park/Mandy Tan |
Laboratory | PS |
Sign in
or
register an account if you want to order this strain.