Strain Information
Name | PS8888 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | dmsr-5(sy1557) III. |
Description | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttgaaaaaaatggttgcagGGTCTACACAGTATTG Right flanking sequence: CATCGGTATTTATGTCTTTTTGTGTGTTTTTTCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGGTCTACACAGTATTGCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
Mutagen | Crispr/Cas9 |
Outcrossed | xNo |
Made by | Heenam Park/Wilber Palma |
Laboratory | PS |
Sign in
or
register an account if you want to order this strain.