Strain Information
Name | PS9520 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | nlp-21(sy1807) III. |
Description | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaaattgatactatgaaacattatatttccagCG right flanking sequence: CTTGTCATGGTGCTCAACGCCCAATACACTTCCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGAGCACCATGACAAGCGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | Heenam Park |
Laboratory | PS |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.