Strain Information
| Name | PS8731 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | lgc-43(sy1496) IV. |
| Description | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cttctaattttcagAAGTTTTAACAACCGAAG right flanking sequence: CGTCAACTGATTCTTCTTCTCCAACATCGAGCATATTTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGAAGAATCAGTTGACGCTT Method Reference: G3 (Bethesda). |
| Mutagen | Crispr/Cas9 |
| Outcrossed | xNo |
| Made by | Heenam Park/Mandy Tan/Wilber Palma |
| Laboratory | PS |
Sign in
or
register an account if you want to order this strain.