Strain Information
| Name | PS9809 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | C01G6.4(sy1916) II. |
| Description | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C01G6.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGGTTCGTCAGACAGCACGATGAGACGCCACTA. Right flanking sequence: CGACGgtaatttactttgtcattcactagtatactg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGATGAGACGCCACTACGA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Heenam Park |
| Laboratory | PS |
Sign in
or
register an account if you want to order this strain.