Strain Information
| Name | PS7220 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | flp-34(sy810) V. |
| Description | flp-34(sy810) is a CRISPR/Cas9-engineered 1,365-bp deletion flanked by the sequences TCAAATTTTTTGAGGAAATCCTCCTGAAAC and AATATTTTCGAGTTTCGAAACATTTCAAAT with a AATATATTTTCGAGTTTCGAAACATATTTTCGAGTTTCGAAACAC insertion. Reference: Lee JS, et al. Proc Natl Acad Sci USA. 2017 Dec 12;114(50):E10726-E10735. PMID: 29167374 |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x3 |
| Made by | Pei Shih |
| Laboratory | PS |
| Reference | Lee, James S. et al. "FMRFamide-like peptides expand the behavioral repertoire of a densely connected nervous system" PNAS, vol 114 (50), 2017, E10726-E10735. doi: 10.1073/pnas.1710374114 |
Sign in
or
register an account if you want to order this strain.