Strain Information

Name PS8693   View On Wormbase
Species C. elegans
Genotypenlp-73(sy1465) V.
DescriptionSuperficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-73. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGCTCATCGCGACCACTGTGCTCATCGCCGAGT right flanking sequence: CTCGTGTATTCTATAACCGATTCGACGGCGGGCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATAGAATACACGAGACT Method Reference: G3 (Bethesda).
MutagenCrispr/Cas9
OutcrossedxNo
Made byHeenam Park/Mandy Tan
Laboratory PS
Sign in or register an account if you want to order this strain.