Strain Information
| Name | PS7911 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | C53C9.2(sy1122)/tmC30[ubc-17(tmIs1243)] X. |
| Description | Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2. lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG; right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda). |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Heenam Park / Han Wang |
| Laboratory | PS |
| Reference | G3 (Bethesda). |
Sign in
or
register an account if you want to order this strain.