Strain Information

Name PS7778   View On Wormbase
Species C. elegans
Genotypeclik-1(sy1084) V.
DescriptionSuperficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
MutagenCrispr/Cas9
Outcrossedx0
Made byHeenam Park
Laboratory PS
Reference G3 (Bethesda).
Sign in or register an account if you want to order this strain.