Strain Information

Name PS8252   View On Wormbase
Species C. elegans
Genotypesrw-36(sy1248) V.
DescriptionSuperficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGACTGTTAACCAATTTCTGATAGGTATCGTAGT Right flanking sequence: TTGTGGGATTATCCACAATGTATGTAGTATCATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGATAGGTATCGTAGTTTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
MutagenCrispr/Cas9
OutcrossedxNo
Made byHeenam Park/Mandy Tan
Laboratory PS
Sign in or register an account if you want to order this strain.