Strain Information
Name | PS9381 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | kcnl-2(sy1755) I. |
Description | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: GAATGGAGCAATTGGAGATGATTCAACAGTTCCAT right flanking sequence: TGATGGACGAAAAAGATGATAACAGgttagttattc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATTCAACAGTTCCATTGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | Heenam Park |
Laboratory | PS |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.