Strain Information
Name | PS8787 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | col-81(sy1520) II. |
Description | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-81. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaatatccctctcaattccagCATCGCCGCCGCTC right flanking sequence: TCATCGCTGTCATCGCCATCCCAGCCTTCTACAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGCGATGACAGCGATGAGAG Method Reference: G3 (Bethesda). |
Mutagen | Crispr/Cas9 |
Outcrossed | xNo |
Made by | Heenam Park/Wilber Palma |
Laboratory | PS |
Sign in
or
register an account if you want to order this strain.