| BS3156 |
C. elegans |
unc-13(e51) gld-1(q485)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. Show Description
Heterozygotes are wild-type and segregate WT heterozygotes, Unc (unc-13 gld-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). XX Uncs have tumorous germline and are sterile; XO Uncs are cross fertile (though they don't mate due to the Unc mutation). q485 is the canonical allele of gld-1. It behaves like deletions of the locus in complementation tests and thus is genetically null. Molecularly, it is a deletion of 82 bases and fails to produce gld-1 RNA and protein.
|
|
| BS3164 |
C. elegans |
unc-32(e189) glp-1(ar202) III. Show Description
Temperature sensitive. Maintain at 15 degrees. Germline tumor formation at 25 degrees. Proximal proliferations defects. Reference: Pepper et al. (2003) Genetics 163(1):115-32.
|
|
| BS3347 |
C. elegans |
lin-45(dx84) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc heterozygotes, non-Unc Steriles (lin-45 homozygotes), larval lethals, and dead eggs. dx84 is a strong lin-45 raf allele: dx84 homozygotes from dx84/+ heterozygotes are 47% larval lethal and among the adults, 100% are Sterile and Vul.
|
|
| BS3348 |
C. elegans |
C07A4.1(ok144) X. Show Description
Primers used to detect the deletion: IQ789.E1: CACACATCGGTCTTCCACAC. IQ789.E2: AATGAAACACCGGAAACTCG. IQ789.I1: TGCAATTGTGTTGCAGGAAT. IQ789.I2: AAAAGAGTGGCTGGCTCGTA.
|
|
| BS3383 |
C. elegans |
pmk-3(ok169). Show Description
F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.
|
|
| BS3392 |
C. elegans |
gld-2(q497) gld-1(q485)/hT2 [dpy-18(h662)] I; unc-32(e189) glp-1(q175)/hT2 [bli-4(e937)] III. Show Description
Heterozygotes are wild-type and segregate WT heterozygotes, Unc (gld-2 gld-1; unc-32 glp-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). Check Unc-32 animals for tumors to confirm presence of glp-1 in the line. glp-1(q175) is nonsense R191 > stop (opal).
|
|
| BS3493 |
C. elegans |
gld-3(ok308)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok308 homozygotes (mostly sterile or Mel, but can be slowly propagated at 20C). Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| BS3727 |
C. elegans |
lip-1(ok154) IV. Show Description
Temperature-sensitive allele. Can be grown at 20C with reduced fertility. Defects in pachytene progression, small oocyte formation and Emo are highly penetrant at 25C. ok154 is a null allele; 1504 bp deletion from -156 bp to +1348 bp, removes the start codon. Reference: Proc Natl Acad Sci USA. Das D, et al. 2022 Jan 18;119(3):e2113649119. PMID: 35022236
|
|
| BS3760 |
C. elegans |
rskn-1(ok159) I. Show Description
Ectopic ERK MPK-1 (detected by dpMPK-1 immunostaining) in the loop region. Reference: Proc Natl Acad Sci USA. Das D, et al. 2022 Jan 18;119(3):e2113649119. PMID: 35022236
|
|
| BS509 |
C. elegans |
ozDf2/dpy-21(e428) par-4(it33) V. Show Description
Heterozygotes are wild-type and segregate wild-type (heterozygotes), Dpys (dpy-21 par-4 homozygotes that lay dead eggs), and dead eggs (ozDf2 homozygotes). Maintain by picking wild-type.
|
|
| BS518 |
C. elegans |
ozDf1/sdc-3(y52y180) unc-76(e911) V. Show Description
Heterozygotes are slow growing with WT phenotype. Hets segregate more slow growing WT, embryonic lethals (ozDf1/ozDf1) and DpyUncs which are sick and have a maternal effect lethal (none of the offspring from the DpyUncs survive to reproduce). Maintain by picking WT.
|
|
| BS5182 |
C. elegans |
sec-61.G(oz1) sma-1(e30) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and Sma. sec-61.G sma-1 homozygotes grow up to be sterile adults, with endomitotic oocytes in the gonad arm. sec-61.G also known as emo-1.
|
|
| BS5183 |
C. elegans |
lin-45(oz201) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, non-Unc Steriles, larval lethals, and dead eggs. oz201 is a strong lin-45 raf allele: oz201 homozygotes from oz201/+ heterozygotes segregate 55% larval lethal and the remaining adults are all Sterile and Vul.
|
|
| BS5351 |
C. elegans |
nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104.
|
|
| BS5431 |
C. elegans |
prp-17(oz273) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| BS5435 |
C. elegans |
prp-17(oz273) I/hT2 (I;III); glp-1(oz264) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
glp-1(oz264) is a gain-of-function allele. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273; oz264 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| BS553 |
C. elegans |
fog-2(oz40) V. Show Description
Male/female strain. Maintain by mating.
|
|
| BS5633 |
C. elegans |
ieSi64 II; lag-1(oz536oz537[lag-1::AID*::3xHA]) IV. Show Description
ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) .
|
|
| BS585 |
C. elegans |
unc-13(e51) ozDf5 I; nDp4 (I;V)/+. Show Description
Strain gives WT hermaphrodites and dead eggs.
|
|
| BS7011 |
C. elegans |
nemp-1(oz534)/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz534) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz534) homozygotes are sterile.
|
|
| BS7012 |
C. elegans |
nemp-1(oz535)/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz535) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz535) homozygotes are sterile.
|
|
| BU8041 |
C. elegans |
pat-3(kq8041) III. Show Description
Mild motility and gonad migration defects. pat-3(kq8041) is an engineered Y804A substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291
|
|
| BU8042 |
C. elegans |
pat-3(kq8042) III. Show Description
Motility and cell (DTC) migration defects. pat-3(kq8042) is an engineered Y804E substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291
|
|
| BU8043 |
C. elegans |
pat-3(kq8043) III. Show Description
Mild motility and cell migration defects. pat-3(kq8043) is an engineered Y804F substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291
|
|
| BY250 |
C. elegans |
vtIs7. Show Description
vtIs7 [dat-1p::GFP]. Integrated reporter with bright GFP observable in all dopaminergic neurons and processes. No behavioral changes have been noted in relation to transgene integration. DA neuron degeneration is evident with easily detectible loss of GFP expression (e.g. Hardaway et al, J. Neurosci, 2015). Reference: Nass, R., et al. (2002). "Neurotoxin-induced degeneration of dopamine neurons in Caenorhabditis elegans." Proc Natl Acad Sci USA 99(5): 3264-3269.
|
|
| BZ555 |
C. elegans |
egIs1 IV. Show Description
egIs1 [dat-1p::GFP]; reportedly maps to LG IV. Bright GFP observable in dopamine neuronal soma and processes. For some reason this strain is resistant to neurotoxic effects of 6-OHDA compared to an independent strain BY200 (Nass et al., 2002). Or maybe BY200 is more sensitive to 6-OHDA due to its co-injection marker gene rol-6?
|
|
| CA1230 |
C. elegans |
htp-3(tm3655) I; ieSi6 II; unc-119(ed3) III. Show Description
ieSi6 [htp-3p::htp-3::GFP + Cbr-unc-119(+)] II. Maintain at 20C. Although silencing of the transgene has not observed, it may be helpful to maintain it over htp-3(tm3655) to continually select for expression. unc-119(ed3) might not be homozygous in this strain. Reference: Kim et al. Dev Cell. 2015 Oct 26;35(2):247-61.
|
|
| CB1112 |
C. elegans |
cat-2(e1112) II. Show Description
Catecholamine absent. Recessive. M-MATING+++ 10-30%WT. See also WBPaper00003844.
|
|
| CB5348 |
C. elegans |
mrt-2(e2663) III. Show Description
Unable to propagate indefinitely: lines become sterile from F10-F28, with short telomeres and fused chromosomes. Hypersensitive to X-irradiation; weak Him phenotype; strong Him phenotype in later generations resulting from X-A fusions. Cross once or twice, freeze down many F2 mrt-2 plates, and go back to these plates every two months for fresh a mrt-2 line. A BstN1 RFLP makes the mrt-2 mutation easy to track.
|
|
| CB7174 |
C. elegans |
ptr-15(e2710e3062) V. Show Description
Intragenic missense revertant. Partly resistant to Leucobacter Verde1. Reference: Stroud et al. (2013) IWM2013Abstract. ptr-15 also known as bus-13.
|
|
| CBX102 |
Microbacterium nematophilum |
Microbacterium nematophilum Show Description
Bacteria. Caenorhabditis pathogen. Previously called Aureobacterium nematophilum. Biosafety Level: BSL-1. The CGC maintains this bacteria on NGM.
|
|
| CER461 |
C. elegans |
nfki-1(cer116[eGFP::nfki-1]) X. Show Description
eGFP tag inserted into the endogenous nfki-1 locus. eGFP::NFKI-1 signal is observed in diverse neurons in the animals' head and tail throughout post-embryonic development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
|
|
| CER588 |
C. elegans |
cat-2(cer181[cat-2p::GFP::H2B 1-3]) II. Show Description
Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: MartÃnez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130
|
|
| CF439 |
C. elegans |
lin-39(mu26) III; dpy-20(e1282) IV; him-5(e1490) V; muIs23. Show Description
muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown. [NOTE: This strain was previously described as carrying lin-39(n1760), but it is actually carrying the g to a substitution of mu26. Strain MT7255 has been confirmed to be carrying the a to t substitution of n1760.]
|
|
| CG118 |
C. elegans |
unc-43(sy574) IV; him-5(e1490) V. Show Description
Males constitutively protract their spicules in the absence of mating cues.
|
|
| CG197 |
C. elegans |
egl-2(rg4) him-5(e1490) V. Show Description
No longer able to suppress male muscle seizures in the absence of food.
|
|
| CGC26 |
C. elegans |
dpy-5(e61)/hT2 [umnIs15] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
|
|
| CGC52 |
C. elegans |
dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs42] III. Show Description
umnIs42 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate2+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
|
|
| CGC86 |
C. elegans |
dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs67] III. Show Description
umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
|
|
| CGC92 |
C.elegans |
dpy-5(e61)/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
|
|
| CL691 |
C. elegans |
dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.
|
|
| CL802 |
C. elegans |
smg-1(cc546) I; rol-6(su1006) II. Show Description
Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CV138 |
C. elegans |
sgo-1(tm2443) IV. Show Description
tm2443 is a 204 bp deletion + 7 bp insertion in 21762/21763-TTTTCTC-21966/21967. A low penetrance (1/25) of chromosome bridges is observed at anaphase I. Reference: de Carvalho et al., Genes Dev 22, 2869-2885.
|
|
| CVB96 |
C. elegans |
siss-1(csn20) IV. Show Description
siss-1(csn20) animals are defective in stress-induced sleep (SIS) with no other obvious defects in development or behavior. csn20 is a Cys-to-Tyr substitution in the third Cys residue of the EGF motif of SISS-1 (a.k.a. IGEG-1). csn20 phenocopies the deletion allele ve532, indicating that the EGF domain of SISS-1 is functional. Reference: Hill AJ, et al. Nat Commun 15, 10886. doi: 10.1038/s41467-024-55252-4. PMID: 39738055.
|
|
| CX20 |
C. elegans |
adp-1(ky20) II. Show Description
Defective in adaptation to a subset of AWC-sensed odorants. Dominant.
|
|
| CX2065 |
C. elegans |
odr-1(n1936) X. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]
|
|
| CYA22 |
C. elegans |
ahcy-1(syb748) I. Show Description
ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.
|
|
| CYA23 |
C. elegans |
ahcy-1(syb748) I; sqIs13. Show Description
sqIs13 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. GFP fluorescence in autophagosomes. RFP fluorescence in AWB and AWC. ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.
|
|
| CZ1566 |
C. elegans |
lin-15B&lin-15A(n765) juIs109 X. Show Description
juIs109 [efn-4::GFP + lin-15(+)] X. Superficailly wild-type. GFP expression detected under high power in a subset of head neurons, primary vulval cells, and a pair of pharyngeal neurons. Reference: Chin-Sang ID, et al. Development. 2002 Dec;129(23):5499-510.
|
|
| CZ16143 |
C. elegans |
juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Show Description
juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. RFP expression in AIY neuron. Weak light green signals were observed in the neurons using compound scope although this is only the former half of the split GFP. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
|
|