More Fields
Strain Species Genotype
BS5351 C. elegans nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104.
JH1463 C. elegans nos-2(ok230) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. The nos-2(ok230) allele is due to deletion of bases 30999 to 33076 of cosmid ZK1127 (GenBank accession U58758) and also deletes a portion of the him-14 gene (him-14 is in an intron of nos-2).
RB1783 C. elegans C16C8.21(ok2301) II. Show Description
C16C8.16. Homozygous. Outer Left Sequence: AAGACGACCACACTCTCGCT. Outer Right Sequence: ACACTGGGAAAAATGTTCGG. Inner Left Sequence: TGCCGATACTAAAGTTCCCG. Inner Right Sequence: GGACTACGGTAGGTGGCAGA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1331 bp. Deletion left flank: ATTGTTCGAAAATTTGATGTCGGAATTGAA. Deletion right flank: GACTGTCAAAGCCGAGCTGAATGTGACGAA. Interpretation of sequence data is very speculative, and should be confirmed independently. Predominant band in PCR of mutants, about 600 bp, is probably not the full-length mutant product. Full-length mutant product is more likely a fainter band of about 1770 bp, which correlates well with deduced breakpoints and relative sizes of various bands produced by single-round amplification with external and internal primer pairs. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1784 C. elegans dnj-27(ok2302) I. Show Description
Y47H9C.5 Homozygous. Outer Left Sequence: aaatctccaatggatgctcg. Outer Right Sequence: accatggagcaaagaaatcg. Inner Left Sequence: gccggtgtgtcataaggatt. Inner Right Sequence: atccatggttccgatgagtc. Inner Primer PCR Length: 3121. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1785 C. elegans Y105E8A.11(ok2303) I. Show Description
Y105E8A.11 Homozygous. Outer Left Sequence: atccgaagcagcaattcaag. Outer Right Sequence: ggatcaaacccaaggatgaa. Inner Left Sequence: tcgattgtgcaatgacgttt. Inner Right Sequence: tttcaagcgaatcaatggag. Inner Primer PCR Length: 3030. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1786 C. elegans Y105E8A.11(ok2304) I. Show Description
Y105E8A.11 Homozygous. Outer Left Sequence: atccgaagcagcaattcaag. Outer Right Sequence: ggatcaaacccaaggatgaa. Inner Left Sequence: tcgattgtgcaatgacgttt. Inner Right Sequence: tttcaagcgaatcaatggag. Inner Primer PCR Length: 3030. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1787 C. elegans F56F11.5(ok2305) III. Show Description
F56F11.5. Homozygous. Outer Left Sequence: ACAAGCTGAAAATGCCCAAC. Outer Right Sequence: ATTGCCAAAAGTTCGATTGC. Inner Left Sequence: CAGAAATGTCCATGAAATTAACAAA. Inner Right Sequence: CAGGCTCCAGTTCGAAGTTT. Inner Primer PCR Length: 3054 bp. Deletion Size: 2283 bp. Deletion left flank: TAACTCGGCTATAGCCTATAGCCGAGTTTC. Deletion right flank: TAATAGTGCCACACTGTGCGTAATTATTAT. Insertion Sequence: TGAGATTTTTCAACTTTTCAAAAAATCTTATAAAATCTAGAATTTTTTTGAATTTTTTA AGCATGATATTTTGGTCTTTATGGCCCCATAGGCATGTTTTAAAGCAATTCCCACACAT AGTGTAGTCCATCTTTAAGTTTCTATGTATAAAAGTAATTTTTACCATTGCTTTTGCTT TGTAGGCAATCGCCATGATTTCCAGACTTCGTTGAGACTTTTCAATTATATAATCACGG TAAGACTTCGAACTATCTTTTCTTGATTGCGAAAACGAGGATGTGTAGTCAGCTTGCAA TGCTTCTATTGCTTGACGTGGTCCCTGTTCCCCATTCAATTGAAGGTGAGTTATTACCT TACACGCAAGTTGTTCAAGTTCTCTGCAAATTTACAATTGAAAACTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1788 C. elegans cyp-35A1(ok2306) V. Show Description
C03G6.14. Homozygous. Outer Left Sequence: AAAGCTTTTGTTGGAGGTGC. Outer Right Sequence: TGATTCCTTTTGGAGTTGGG. Inner Left Sequence: GATGCATAGTAAGGAAATCTGGG. Inner Right Sequence: TCCACTACCGAGCTTATGCC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1494 bp. Deletion left flank: TTGATATCCTCAATTCTAAATCAAGCAATC. Deletion right flank: TCACCAGAATACAATTTAAAAACCTTTAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1789 C. elegans met-2(ok2307) III. Show Description
R05D3.11. Homozygous. Outer Left Sequence: AGGGTTTCGGTTTTTCGATT. Outer Right Sequence: TATCTTTGGAGTGCCGGTTT. Inner Left Sequence: CGTCCCGTATATTTTTCAACG. Inner Right Sequence: CCGTTTTGAAATTTGTTTCCTT. Inner Primer PCR Length: 3056 bp. Deletion Size: 1320 bp. Deletion left flank: AAAAAGGAGAAAGAAATCATGAAAATTTTG. Deletion right flank: GTTACGGAGGAGACGAGTCAGATTATGATG. Insertion Sequence: AAAAAAAATTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1770 C. elegans Y73B6BL.1(ok2308) IV/nT1 [qIs51] (IV;V). Show Description
Y73B6BL.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2308 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCGAGAAGAGTACGCAGC. External right primer: GCATAAAAATTCCTGCCTGC. Internal left primer: CGGAATCCGAAAATGCATAC. Internal right primer: AGCTTTCCCCCGATTGTACT. Internal WT amplicon: 3151 bp. Deletion size: 1058 bp. Deletion left flank: GAAAATAAATTGAAAAATAATTTTTCAGGG. Deletion right flank: TAACAAGTTATAGCCGCAATGAATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1779 C. elegans F52H3.2(ok2309) II. Show Description
F52H3.2. External left primer: GCAATGTGCAACAAAATGCT. External right primer: CGATTGAAACCCGTTTTTGT. Internal left primer: CTGCCAGATTTCTTGGTCGT. Internal right primer: ACGCTGTTGATTTTTGCCTT. Internal WT amplicon: 2254 bp. Deletion size: 1310 bp. Deletion left flank: AGATAAAGTCGAAACTCCGCACGAGAAGTT. Deletion right flank: TTTTCAATTTTGTAACCTTTTCCGATTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1895 C. elegans +/mT1 II; cyk-1(ok2300)/mT1 [dpy-10(e128)] III. Show Description
F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807