Strain Information
| Name | CX2065 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | odr-1(n1936) X. |
| Description | Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.] |
| Mutagen | EMS |
| Outcrossed | x2 |
| Made by | C. Bargmann |
| Laboratory | CX |
Sign in
or
register an account if you want to order this strain.