Search Strains

More Fields
Strain Species Genotype Add
FA85 C. elegans sand-1(or552) IV. Show Description
Temperature-sensitve sterile. Maintain at 15-20C. Superficially wild-type at permissive temperatures; contains large bubble-like structures on the inside in all stages (described as large early endosomes), reduced brood size. Sterile and very sick at 25°C with some single escapers that are sterile and sick themselves. Suppressors have been observed after long culturing over several months, periodically check for sterility at 25C.
FAS65 C. elegans his-69&his-70(uge44) III. Show Description
Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FC50 C. elegans zzEx10. Show Description
zzEx10 [(pJE3) eff-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. eff-1p expression is observed in epithelia committed to fusion and in fused syncytia.
FGP1 C. elegans unc-119(ed3) III; fgpIs20. Show Description
fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
FGP3 C. elegans unc-119(ed3) III; fgpIs23. Show Description
fgpIs23 [(pFGP78) pie-1p::GFP::TEV-S-Tag::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
FGP7 C. elegans unc-119(ed3) III; ruIs57; fgpIs20. Show Description
ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Expression of GFP::tubulin fusion in germline and early embryos. fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
FGP8 C. elegans unc-119(ed3) ruIs32 III; fgpIs20. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Expression of GFP::H2B histone fusion in germline. fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
FK171 C. elegans mek-1(ks54) sek-1(qd127) X. Show Description
Hypersensitive to copper and cadmium ions, and to starvation. [NOTE: Prior studies suggested possible cross-regulation of PMK-1 by MEK-1, but the identification of a tightly linked partial loss-of-function mutation in sek-1(qd127) in the strain carrying the mek-1(ks54) mutant allele (K. Reddy and D. Kim, unpublished data) suggests that the diminished PMK-1 activation observed in this mutant strain may actually be due to diminished SEK-1 activity.]
FT1197 C. elegans unc-119(ed3); xnIs449. Show Description
xnIs449 [lin-26::lifeAct::GFP + unc-119(+)]. LifeAct-GFP expressed in epidermal cells of embryos. In adults, expression is also observed in pharynx and some cells in the tail. Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744.
FX301 C. elegans gsp-2(tm301) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Maintain by picking wild-type GFP+. Heterozygotes are WT GFP+ and should segregate WT GFP+ heterozygotes, non-GFP gsp-2 homozygotes (embryonic lethal), very rare GFP+ homozygous hT2, and dead eggs. hT2[qIs48] animals are recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GC363 Escherichia coli E. coli. Show Description
Bacteria. E. coli HT115(DE3) bacterial strain carrying pGC8. pGC8 is a partial cDNA of him-14 (ZK1127.11) cloned into the Timmons and Fire "double T-7 vector" L4440. The source of the cDNA is Yuji Kohara's clone yk240h12. pGC8 was constructed by inserting the 1.65kb KpnI/SacI fragment of the him-14 cDNA (from base pair 1071 to 192 base pairs beyond the stop codon) into the same sites in L4440. HT115(DE3) carrying pGC8 should be selected in the presence of 50 um/ml tetracyline and 100 um/ml ampicillin. Prior to an actual feeding experiment, it can be grown in liquid in the presence of amp alone (no tet) and then seeded onto NGM plates containing amp and 1 mM IPTG. This technique does not work well if the cells are old; therefore, the strain should be seeded onto IPTG-containing plates from a fresh overnight that was grown from a colony on an amp/tet plate. Biosafety Level: BSL-1. For more info see http://www.wormbook.org/wli/wbg17.1p32/
GL347 C. elegans zcIs13 V. Show Description
zcIs13 [hsp-6p::GFP + lin-15(+)] V. Stable transgenic line with GFP expression mainly in the posterior intestine, observed from L1 to adult. Perturbation of mitochondrial folding environment induces robust GFP expression throughout the intestines. Derived by outcrossing parental strain SJ4100 to N2 six times to remove suspected background mutations causing uneven transgene expression and low penetrance of sterility.
GR1318 C. elegans pdk-1(mg142) X. Show Description
No visible phenotype. Dominant suppressor of daf-c phenotype of age-1. Ala303Val substitution.
HA1706 C. elegans pha-1(e2123) III; rtEx726. Show Description
rtEx726 [del-1p::YC2.60 + pha-1(+)] expresses yellow cameleon YC2.60 in a subset of motor neurons. Maintain at 25C to select for the presence of the array. Haspel G, et al. (2010) J. Neurosci. 30:11151-6.
HA2825 C.elegans smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. Show Description
rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752
HA2846 C.elegans fust-1(rt256[R446S]) II. Show Description
fust-1(rt256[R446S]) was created by CRISPR editing of arginine codon in C. elegans fust-1 to create FUS disease model for human mutation R524S. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2846 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
HA2847 C.elegans fust-1(rt257[P447L]) II. Show Description
fust-1(rt257[P447L]) was created by CRISPR editing of proline codon in C. elegans fust-1 to create FUS disease model for human mutation P525L. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2847 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
HA2987 C. elegans sod-1(rt449[G93AC]) II; vsIs48. Show Description
vsIs48 [unc-17::GFP]. Superficially wild-type at 25C. Can be maintained 15-25C, and latent defects observed after oxidative stress. GFP expressed in all cholinergic neurons. rt449 was created by CRISPR editing of the cognate glycine codon in C. elegans sod-1 to create a disease model for human mutation SOD1 G93A. This strain contains additional silent edits in sod-1, and was back-crossed to remove the edited pha-1 allele used in strain construction. The appropriate control is HA2986. Reference: Baskoylu S, et al. PLOS Genetics (https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007682). NOTE: A micropublication (PMID: 33474528) incorrectly described sod-1 alleles in the text. This strain contains rt449, which is sod-1[G93AC], while rt451 is sod-1[G85RC] and rt448 is the wild-type control for both.
HA3299 C. elegans sod-1(rt451[sod-1(G85RC)]) II. Show Description
Superficially wild-type at 25C. Can be maintained 15-25C, and latent defects observed after oxidative stress. rt451 was created by CRISPR editing of the cognate glycine codon in C. elegans sod-1 to create a disease model for human mutation SOD1 G85R. This strain contains additional silent edits in sod-1, and was back-crossed to remove the edited pha-1 allele used in strain construction. The appropriate control is HA2986. Reference: Baskoylu S, et al. PLOS Genetics (https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007682). NOTE: A micropublication (PMID: 33474528) incorrectly described sod-1 alleles in the text. This strain contains rt451, which is sod-1[G85RC], while rt449 is sod-1[G93AC] and rt448 is the wild-type control for both.
HB101 Escherichia coli E. coli [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]. Show Description
Bacteria. This strain of E. coli is easier for worms to eat than other E. coli strains. [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]. Contains a mutation (rpsL20) in a ribosomal subunit gene that confers streptomycin resistance. Biosafety Level: BSL-1.
HP17 C. elegans sos-1(pd10) V. Show Description
sos-1 gain-of-function allele originally isolated as a suppressor of sem-5(n1619) lethality. pd10 causes a E99K substitution within the N-terminal histone fold domain of SOS-1. Single mutants appear wild-type.
HP23 C. elegans sos-1(pd9) V. Show Description
sos-1(pd9) is a gain-of-function allele causing a C662Y substitution within the Ras exchange motif of SOS-1. Originally isolated as a suppressor of sem-5(n1619) lethality. Single mutants appear wild-type. Reference: Wooller A & Hopper N. (2014) European Worm Meeting. (Anyone using this allele may cite Neil Hopper as a personal communication based on this meeting abstract.)
HS1339 C. elegans osIs2. Show Description
osIs2 [CYE-1::GFP (pMF101) + unc-76(+)]; probably integrated on LG X. No dominant phenotypes observed (see HS1337). Expression in many blast cells can be detected, but much weaker than osIs1. Reference: Fujita et al. PLoS ONE 2, e407 (2007).
HS169 C. elegans nob-1(os6) III. Show Description
Tail abnormal. Defects in asymmetric T cell division causes Psa (phasmid socket absent) phenotype.
HS178 C. elegans psa-3(os8) X. Show Description
Superficially WT. Defects in asymmetric T cell division causes Psa (phasmid socket absent) phenotype.
HS184 C. elegans swsn-4(os13) IV. Show Description
Egl, Pvul, Psa (Phasmid Socket Absent) and some embryonic lethality. The T cell division can be symmetric as in lin-17 mutants. Less severe at 15C. swsn-4 encodes a homolog of yeast SW12, a component of the SWI/SNF complex.
HS304 C. elegans swsn-1(os22) V. Show Description
Temperature sensitive. At 22.5C, maternal effect embryonic lethal. Temperature shift-up to 22.5C during embryogenesis results in animals with Egl, Pvul and Psa (phasmid socket absent) phenotypes. Shift-up to 25C results in growth arrest at larval stage. The T cell division can be symmetric as in lin-17 mutants. At 15C, nearly WT. Males grown at 15C can mate very well. psa-1 encodes a homolog of yeast SW13, a component of the SWI/SNF complex. Sequence data of this strain revealed the mutation is actually GTC/CCC/TCA to GTC/CTC/TCA causing a P86L substitution (G. Hayes).
HS411 C. elegans ceh-20(os39) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. Segregate GFP- sterile Unc Psa (phasmid socket absent), very rare homozygous hT2 glowing animals, and dead eggs. ceh-20(os39) animals show defects in asymmetric T cell division.
HS634 C. elegans rnt-1(os58) I. Show Description
Phasmid socket absent.
HS661 C. elegans nob-1(os68) III. Show Description
Healthy. Abnormal morphology of the tail (only at Nomarski level). Defects in asymmetric T cell division causes Psa (phasmid socket absent).
HS732 C. elegans wrm-1(tm514) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm514 homozygotes (probable embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain.
HS886 C. elegans bet-1(os46) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP in the pharynx, and segregate WT GFP+, Sterile Psa(Phasmid socket absent) non-GFP homozygous os46) animals and dead eggs. Maintain by picking GFP progeny. Reference: Shibata et al. Development in press (2010).
HT115(DE3) Escherichia coli E. coli [F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase]. Show Description
Bacteria. Genotype: F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase) (IPTG-inducible T7 polymerase) (RNAse III minus). This strain grows on LB or 2XYT plates. This strain is tetracycline resistant. Researchers using this strain should test for expression by transforming in one of the plasmids from the Fire Vector Kit (1999) (pLT76, e.g.) using standard CaCl2 transformation techniques. Biosafety Level: BSL-1.
HT1361 C. elegans lpIs32. Show Description
lpIs32 [ftt-2::gfp + rol-6]. Rollers. FTT-2::GFP is expressed strongly in the pharynx, and can be observed in the neurons in the head, body and tail, and also weakly expressed in the intestine. Reference: Wang Y, et al. Mech Ageing Dev. 2006 Sep;127(9):741-7. PMID: 16860373.
HX103 C. elegans chd-3(eh4) X. Show Description
T14G8.1 Deletion of 2018 bp of T14G8.1 [nucleotide 3699 (in exon 4) joined to 1682 (in exon 6)]. No phenotype observed.
HZ771 C. elegans him-5(e1490) V; bpIs90. Show Description
bpIs90 [tia-1p::tia-1::GFP + rol-6(su1006)]. Rollers. Rolling phenotype is more apparent when raised >20C. TIA-1::GFP is homogenously distributed in the cytoplasm during embryogenesis. At larval stages, diffuse TIA-1::GFP signals are observed in seam cells and hypodermal cells. TIA-1::GFP forms distinct bodies, especially in seam cells and hypodermal cells, under stress conditions. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.
HZ946 C. elegans rpl-43(bp399) II; bpIs151. Show Description
bpIs151 [sqst-1p::sqst-1::GFP + unc-76(+)]. bp399 mutants accumulate SQST-1 aggregates strictly in the intestine in a distinct temporal pattern. SQST-1::GFP aggregates are absent in bp399 embryos, but start to form in L1 larvae and increase in number and size throughout larval development. Reference: Guo B, et al. EMBO Rep. 2014 Jun;15(6):705-13.
IG256 C. elegans xnp-1(tm678) I. Show Description
Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59.
IG358 C. elegans oxEx229. Show Description
oxEx229 [Mos1 Substrate + myo-2::GFP]. Pick GFP+ to maintain. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.
iOP50 E. coli OP50 E. coli, rnc14::(delta)Tn10, lacz(gamma)A::T7pol camFRT Show Description
RNAi-capable OP50 strain. Tetracycline & Chloramphenicol resistant. Uracil auxotroph. E. coli B. Biosafety Level: BSL-1. Standard OP50 (CGC) was rendered RNAi competent through two modifications by phage transduction. The OP50 RNase III (rnc) allele was replaced with the deletion allele (rnc14::?Tn10) found in HT115(DE3), and a genomically encoded IPTG-inducible T7 RNA polymerase (lacz?A::T7pol camFRT) was introduced. Reference: Neve IAA, et al. G3 (Bethesda). 2019 Nov 11. pii: g3.400741.2019.
IX4506 C elegans mls-2(vy248[mNG::mls-2]) X. Show Description
mNG tag inserted into endogenous mls-2 locus after the start codon using CRISPR/Cas9 engineering, producing a translational mNG::MLS-2 reporter protein. Derived by SEC excision of mls-2(vy247[mNG::SEC::mls-2 knock-in]) in parental strain. mNG::MLS-2 is detected in the nucleus of a few cells in embryos, and localizes to the nucleus of a subset of head cells and the M mesoblast in larvae and adults. Reference: Xiong R., et al. (2022). mNG-tagged mls-2 knock-in alleles in C. elegans. microPublication Biology. 10.17912/micropub.biology.000529.
JEL1197 C. elegans wrdSi3 II; dpy-27(xoe41[dpy-27::AID::myc]) III; him-8(me4) IV. Show Description
wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Endogenous dpy-27 locus tagged with AID* element and myc to create a conditional allele using the auxin-inducible degron (AID). In absence of auxin, ~40% of worms are male due to him-8(me4) mutation. In the presence of auxin, ~100% of worms are male (hermaphrodite-lethal due to degradation of AID-tagged DPY-27). Reference: Li Q, et al. Inducible degradation of dosage compensation protein DPY-27 facilitates isolation of Caenorhabditis elegans males for molecular and biochemical analyses. bioRxiv 2022.01.27.478040; doi: https://doi.org/10.1101/2022.01.27.478040.
JH2787 C. elegans pptr-1(tm3103) V. Show Description
pptr-1(tm3103) is a temperature-sensitive allele. Maintain at 15C. Fully penetrant P granule partitioning defect at 20-24C. Low penetrance of sterilty observed at 24-26C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH3182 C. elegans gtbp-1(ax2035[gtbp-1::TetraCys]) IV. Show Description
Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCAC GT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3184 C. elegans gtbp-1(ax2037([gtbp-1::Myc]) IV. Show Description
Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3186 C. elegans gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JK590 C. elegans glp-1(q35)/eT1 III; him-5(e1490)/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type heterozygotes, glp-1(q35) homozygotes (Muv steriles), eT1 homozygotes (Unc-36), and males. glp-1(q35) has a semi-dominant multi-vulva phenotype as well as the loss-of-function Glp phenotype (sterility and embryonic lethality). The q35 mutation is a nonsense mutation that eliminates 122 C-terminal amino acids including a PEST sequence. The C terminus was thought to contain a negative regulatory domain that inactivates glp-1 in the VPCs; the inappropriate glp-1(q35) activity can substitute for lin-12 vulval fate determination. References: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99. Mango S, et al. Nature. 1991 Aug 29;352(6338):811-5.
JK6540 C. elegans gld-1(q1242) I. Show Description
q1242 is an engineered TGT to ACA substitution in FBEa1 of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6550 C. elegans fbf-2(q1264[*q1011])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H326A, Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6568 C. elegans gld-1(q1257) I. Show Description
q1257 is an engineered TGT to ACA substitution in FBEb of the endogenous gld-1 locus. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.