More Fields
Strain Species Genotype
JH3180 C. elegans nos-2(ax2033) II. Show Description
Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3193 C. elegans nos-2(ax2049[3XFLAG::nos-2]) II. Show Description
Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23.
BS5351 C. elegans nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104.
JH1463 C. elegans nos-2(ok230) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. The nos-2(ok230) allele is due to deletion of bases 30999 to 33076 of cosmid ZK1127 (GenBank accession U58758) and also deletes a portion of the him-14 gene (him-14 is in an intron of nos-2).
JH1270 C. elegans nos-1(gv5) II. Show Description
No visible phenotype except for reduced brood size. Synthetic sterile with nos-2(RNAi). 1176 bp deletion starting at aa 58 in nos-1 ORF and ending 414 bp past the end of the nos-1 ORF.
JH1999 C. elegans unc-119(ed3) III; axIs1448. Show Description
axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Superficially wild-type. Reference: Merritt C, et al. Curr Biol. 2008 Oct 14;18(19):1476-82.
JH2171 C. elegans unc-119(ed3) III; axIs1586. Show Description
axIs1586 [pie-1::LAP::glh-1::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in P-granules of distal germline.
JH2281 C. elegans unc-119(ed3) III; axIs1729. Show Description
axIs1729 [pie-1p::LAP tag::mCherry::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2791 C. elegans pptr-1(tm3103) V; axIs1448. Show Description
axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
WRM1 C. elegans sprSi1 II; unc-119(ed3) III. Show Description
sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WRM2 C. elegans sprSi2 II; unc-119(ed3) III. Show Description
sprSi2 [pie-1p::GFP::histone-H2B::nos-2 3'UTR + Cbr-unc-119(+)] II. Fluorescence in all cells of early embryo. This fluorescence reporter has mutations in both MEX-3 binding sites and shows ectopic expression relative to strain WRM1. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.