Search Strains

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h842 arrests as a sterile adult, and the unlinked mutation results in a tumorous gonad phenotype). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Wild-type to mildly long phenotype, sometimes a bit Unc. Segregates wild-type, Dpy-18 (hT2[dpy-18 bli-4] homozygotes), hDf10 dpy-5 unc-29 homozygotes (probably dead eggs) and large numbers of aneuploids (dead eggs). dpy-18(h662) completely suppresses bli-4(e937), is only very mildly Dpy, and has a distinctive dark body and large clear vulval region as a young adult, before becoming gravid. Do not passage: hT2 homozygotes seem somewhat healthier than the het, and will overgrow the plate. Pick longish wild-types and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

kasIs7 [snb-1p::C9 ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: https://pubmed.ncbi.nlm.nih.gov/34654821/

kasIs9 [snb-1p::(delta)C9 ubi + myo-2::GFP]. The transgene has the snb-1 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: https://pubmed.ncbi.nlm.nih.gov/34654821/

ckSi17 [cdk-12::GFP::mex-5 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi20 [cdk-9::mCherry::mex-5 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi21 [cdk-9::GFP::pal-1 3'UTR + unc-119(+)] II. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi21 [cdk-9::mCherry::pal-1 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. hT2 segregates WT green-glowing heterozygotes and non-GFP cdk-9 homozygotes (normally arrest as L1-L2 larvae; cdk-9 homozygotes carrying ckSi21 (GFP- mCherry+) are viable but sterile. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).

bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Temperature-sensitive germ cell apoptosis leading to infertility at 25 C. Apoptosing germ cells are decorated by CED-1::GFP in the gonad. Loss of p170 form of IFG-1 (but not p130 IFG-1) confirmed by Western blot. Escaping eggs are fertilized and embryonic lethal. Mos-1 transposon insertion previously described as ifg-1::mos-1(cxP9279) II; confirmed by triple primer PCR with 5’-ACCAAACTGGGCAAACAAAG-3’, 5’-GCTCAATTCGCGCCAAACTATG-3’, and 5’-CTTCCTGAAATTTGGTTTAACAGT-3’. Homozygous ifg-1::mos yields only 444 bp product. Outcrossed heterozygotes yield both 353 bp (wild type ifg-1) and 444 bp products.

bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. ced-3 deletion confirmed by genomic triple primer PCR with 5’-AGTTCACCGTGACAGCGTCTCTTC-3’, 5’-CGATTACGACTTGAACTGTATCCGA-3’, and 5’-TCTTGTGTAAACGAGATTTGCAATG-3’. Homozygous ced-3(n2452) yields only 1,110 bp product. Outcrossed heterozygotes yield both 1,411 bp (wild type ced-3) and 1,110 bp products. [NOTE: (11-05-2019) A user has reported this strain exhibits temperature-sensitive sterility when raised at 25C.]

ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Reference: Zhang P, et al. Mol Cell Proteomics. 2012 Aug;11(8):317-28.

cp13[nmy-2::gfp + LoxP] I. GFP inserted into the endogenous nmy-2 gene by Cas9-triggered homologous recombination. Green fluorescence in many tissues, especially the germline. Fluorescence is similar to, but brighter than, the nmy-2::GFP transgene zuIs45. Reference: Dickinson DJ, et al. 2013 Nature Methods Advance Online Publication. DOI: 10.1038/nmeth.2641.

cpSi171 [vha-8p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in multiple tissues including intestine, hypodermis, and excretory cell.

cpSi172 [myo-2p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in the pharynx.

cpSi174 [myo-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in body wall muscle.

lstEx24 [pdf-2p::pdf-2::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. lst24 rescues pdf-2; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (dauer escapers will be Par and give only dead eggs), and DpyUcs which arrest as dead eggs (range from twitching multicellulars to 3-folds that hatch). [There is a greater percentage of hatchlings when the mother is heterozygous (wc1 dpy-1/+). There may also be the possibility of near complete maternal rescue (near full-sized, sterile Dpys), but this has not been routinely observed in the balanced strain (as opposed to wc1 dpy-1/+).] Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: The dauers are not giving dead eggs-they are giving other dauers. Appears that the Par mutation is no longer present.]

Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (escapers will be Par and give only dead eggs) and DpyUncs which are dead eggs (a range of embryonic lethality from multicellular twitchers to 3-folds that do not hatch). Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: the dauers are giving dead eggs.]

jjIs709 [(pDRNL1) + lmn-1p::GFP::lmn-1::unc-54 3'utr + (pMH86) dpy-20(+)] I. GFP-tagged LMN-1 is expressed in all somatic cells. Reference: Haithcock E, et al. (2005) PNAS 102:16690-5.

vsIs183 [nlp-3p::GCaMP5::nlp-3 3'UTR + nlp-3p::mCherry::nlp-3 3'UTR + lin-15(+)] X. Integrated transgene using nlp-3 promoter to drive GCaMP5 and mCherry expression in HSN; useful for visualizing and quantitating calcium influx in HSN. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.

Heterozygotes are Unc but not Lon. n496 is dominant. Segregates LonUnc. vs98 homozygotes are non-Unc, non-Lon and are Mel (they give only dead eggs). Strain will break down due to recombination so check for the presence of vs98 by PCR every few generations. Received new stock Feb 2005.

bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. [NOTE: MD4195 can be maintained at 20C instead of 15C because it does not carry an array with guide RNAs targeting essential genes.] Generated in parental strain EG8081. Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.

bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1367 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1367 array contains a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.

bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.

bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1370 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-1 locus) + U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1370 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I) and a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.

otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. Rollers.

otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. norEx42 [ast-1 Cosmid + ttx-3::GFP + dat-1::mCherry]. Rollers. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.

Heterozygotes are WT and segregate WT, DpyUncs, and Dpys which give only dead eggs. Throws males.

risIs3 [K02A4.1p::K02A4.1::GFP + unc-119(+)]. Superficially wild-type. GFP mainly in head region and body wall muscle. Reference: Mansfeld J, et al. Nat Commun, 2015 Dec 1;6:10043.

risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511.

risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and ZG31.

risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and PS3551.

risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and TJ375.

GFP::3xFLAG tags inserted at N-terminus of endogenous lin-45 locus. Wild-type morphology. Reference: Townley R, et al. Sci Signal. 2023 Aug 29;16(800):eabq4355. doi: 10.1126/scisignal.abq4355. PMID: 37643243.

Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon males, mc46 hemizygotes (WT males) and mc46 homozygotes. mc46 is a deletion that results in homozygotes which show enlarged vacuoles (late endosomes and lysosomes) and lay eggs with enlarged vacuoles that die at different stages of embyronic development.

lucIs39 [tbx-37p::mNeonGreen::2xNLS::tbx-37 3'UTR + pal-1p::mScarlet-I::2xNLS::tbb-2 3'UTR + med-2p::mScarlet-I::2xNLS::tbb-2 3'UTR]. Wild-type morphology. Integrated array allows for labeling and sorting of ABa and ABp descendants by FACS. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

Maternal effect Uncoordinated and Dumpy. High degree of embryonic and larval lethality. Dpy phenotype only partially resuced. Hatchlings are of variable length, with poor movement. Adults are short and show kinky uncoordination.

Maternally rescued Dpy. Fully zygotically rescued but only partially maternally rescued. Some embryonic lethality and a high degree of larval lethality. Very poor embryonic elongation. Hatchlings are short and deformed. In later stages the anterior half of the body is short but well developed while the posterior is thin.

Nuclear Ultrabright GFP::mNeonGreen Fluorescent protein (NuGFP) tag inserted downstream of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. NuGFP cassette is composed of an intercistronic region (ICR) from the C. elegans SL2-type operon, a SV40 nuclear localization sequence (NLS), the coding sequence of GFP, the coding sequence of mNeonGreen, and egl-13 NLS. The expression of NuGFP is tied to that of the endogenous daf-2, but after trans-splicing, the NuGFP protein is synthesized independently of DAF-2. This high-sensitivity daf-2 expression reporter was readily detectable in most C. elegans cells throughout development and adulthood. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

irIs25 [elt-2::NLS::GFP::lacZ + rol-6(su1006)] V.

syIs423 [15xUAS::?pes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. mirIs19 [nlp-12p::gal-4 + unc-122p::mCherry]. Maintain animals at 25C for several generations to enhance mKate expression in DVA to make it visible with a fluorescence dissection scope. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

mirIs71 [nlp-12p::CRE + myo-2p::mCherry]. DVA-specific CRE driver. Superficially wild-type. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

Phenotype: small, scrawny, thin, lays few eggs. unc-93(e1500) rubberband phenotype is completely suppressed by sup-11(n403) so only sup-11 phenotype is visible. n403 is semidominant.

Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, Sterile Muv, and males. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. The male phenotype similarly is heat sensitive; only males that are the progeny of lin-13 hermaphrodites and are grown at 20C or 25C have ventral protrusions. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.

Deletion breakpoints: ATCGGGATGAAGTTTGCAAA//AATCTAGAATACCGATTTCG. Transposon silencing abnormal. Only enhanced transposon activity observed in n4503; nDf57 mutants compared to n4503 (not in nDf57 mutants alone).

nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. Extra GFP+ M4 observed in nIs175. Reference: Takashi H, et al. PNAS 2010 Aug 31;107(35):15479-84.

nIs177 [ceh-28p::4NLS::GFP + lin-15(+)]. Extra ceh-28p::4NLS::GFP-expressing M4 seen in nIs177 (~30% penetrance). Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.