| GH383 |
C. elegans |
glo-3(zu446) X. Show Description
Class II allele. Partial loss of gut granules (birefringence) in intestinal cells and low penetrance of mislocalized birefringent material into the intestinal lumen. Reference: Rabbitts et al. (2008) Genetics 180:857-871.
|
|
| GH403 |
C. elegans |
glo-3(kx94) X. Show Description
Class I allele. Complete loss of gut granules (birefringence) in intestinal cells and mislocalization of birefringent material into the intestinal lumen. Reference: Rabbitts et al. (2008) Genetics 180:857-871.
|
|
| GJ20 |
C. elegans |
dpy-20(e1282) IV; pkIs1201. Show Description
pkIs1201 [gpa-3::GFP + dpy-20(+)].
|
|
| GJ7 |
C. elegans |
gpa-2(pk16) gpa-3(pk35) gpa-13(pk1270) V; gpa-5(pk376) gpa-6(pk480) X. Show Description
Lans H, et al. Genetics. 2004 Aug;167(4):1677-87.
|
|
| GLW43 |
C. elegans |
edc-3(utx35[mNG::3xFlag::edc-3]) I. Show Description
N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.
|
|
| GLW57 |
C. elegans |
asp-3(utx47[mNG::3xFlag::asp-3]) X. Show Description
N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58.
|
|
| GOU2162 |
C. elegans |
che-3(cas443[gfp::che-3]) I; xbx-1(cas502[xbx-1::tagRFP]) V. Show Description
Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous che-3 locus at the N-terminus and tagRFP::3xFlag inserted into the endogenous xbx-1 locus at the C-terminus by Cas9-triggered homologous recombination. Fluorescence enriched in most if not all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
|
|
| GOU2364 |
C. elegans |
che-3(cas528[gfp::che-3(R1384C)]) I. Show Description
GFP inserted into the endogenous che-3 gene at its N-terminus and R1384C mutation introduced by Cas9-triggered homologous recombination. Lipophilic dye filling is superficially wild-type and the amphid and phasmid sensory cilia are mildly shortened without evident IFT particle accumulation.
|
|
| GOU2365 |
C. elegans |
che-3(cas512[gfp::che-3(R1693C)]) I. Show Description
GFP inserted into the endogenous che-3 gene at its N-terminus and R1693C mutation introduced by Cas9-triggered homologous recombination. Lipophilic dye filling is 100% defective and the amphid and phasmid sensory cilia are severely shortened without evident IFT particle accumulation.
|
|
| GOU2366 |
C. elegans |
che-3(cas511[gfp::che-3(K2935Q)]) I. Show Description
GFP inserted into the endogenous che-3 locus at its N-terminus and K2935Q mutation introduced by Cas9-triggered homologous recombination. Lipophilic dye filling is 100% defective and the amphid and phasmid sensory cilia are severely shortened with strong IFT particle accumulation.
|
|
| GR1311 |
C. elegans |
daf-3(mgDf90) X. Show Description
mgDf90 completely eliminates the daf-3 coding region.
|
|
| GR1321 |
C. elegans |
tph-1(mg280) cam-1(vs166) II. Show Description
Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.
|
|
| GR1322 |
C. elegans |
pdk-1(sa680) X; mgEx470. Show Description
mgEx470 [pdk-1(+) + ttx-3::GFP]. Pick GFP+ to maintain. 9.2-kb PCR product of genomic DNA from the pdk-1(+) genomic region containing 2.7 kb of 5' upstream regulatory sequence, 6.1 kb of coding sequencing containing introns and exons, and 0.4 kb of pdk-1 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.
|
|
| GR1395 |
C. elegans |
mgIs49 IV. Show Description
mgIs49 [mlt-10p::GFP::PEST + ttx-3::GFP] IV. GFP expression oscillates with molting cycle. Reference: Veli SM, et al. Mol Biol Cell. 2010 May 15;21(10):1648-61. PMID: 20335506.
|
|
| GR1452 |
C. elegans |
veIs13 V; let-7(mn112) unc-3(e151) X; mgEx725. Show Description
veIs13 [col-19::GFP + rol-6(su1006)] V. mgEx725 [lin-4::let-7 + ttx-3::RFP]. Pick RFP+ to maintain. mgEx725 rescues lethality of let-7(mn112). Precocious expression of col-19::GFP at the L4 stage. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
|
|
| GR1719 |
C. elegans |
unc-119(ed3) III; mgSi3 IV. Show Description
mgSi3 [(pCMP2)ubl-1p::GFP::ubl-1-3'UTR + Cbr-unc-119(+)] IV. Strong ubiquitous GFP expression. Can be used as a control for a strain containing an endogenous siRNA sensor (GR1720). Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.
|
|
| GR1720 |
C. elegans |
unc-119(ed3) III; mgSi4 IV. Show Description
mgSi4 [(pCMP2)ubl-1p::GFP::siR-1-sensor-ubl-1-3'UTR + Cbr-unc-119(+)] IV. Very weak ubiquitous GFP expression. The 22G siR-1 sensor transgene is more sensitive to gene inactivations that affect 22G siR-1 levels when grown at 25C compared to 20C. Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.
|
|
| GR2183 |
C. elegans |
mgIs72 II. Show Description
mgIs72 [rpt-3p::GFP + dpy-5(+)] II. Reporter of proteasome subunit expression can be used to assay skn-1a-dependent regulation of proteasome subunit genes. mgIs72 [rpt-3::gfp] integrated transgene was generated from sEx15003.
|
|
| GS195 |
C. elegans |
f="/strain/search?st1=ncl-1&sf1=all">ncl-1(f="/strain/search?st1=e1865&sf1=all">e1865) f="/strain/search?st1=unc-36&sf1=all">unc-36(f="/strain/search?st1=e251&sf1=all">e251) f="/strain/search?st1=glp-1&sf1=all">glp-1(f="/strain/search?st1=q46&sf1=all">q46) f="/strain/search?st1=mua-3&sf1=all">mua-3(f="/strain/search?st1=ar62&sf1=all">ar62) III; f="/strain/search?st1=qDp3&sf1=all">qDp3 (III;f). Show Description
Animals with the duplication are WT and segregate WT and larval lethals. Larval muscle detachment and arrest at about L1 stage in mua-3(ar62) homozygotes. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS2526 |
C. elegans |
arIs37 I; mca-3(ar492) dpy-20(e1282) IV. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. mca-3 is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS2527 |
C. elegans |
arIs37 I; mca-3(ar493) dpy-20(e1282) IV. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. mca-3 is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS2532 |
C. elegans |
arIs37 I; cup-3(ar498) II; dpy-20(e1282) IV. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cup-3 is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS314 |
C. elegans |
evl-3(ar100)/dpy-10(e128) unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, Steriles with and Everted Vul and DpyUncs. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS318 |
C. elegans |
evl-3(ar99)/dpy-10(e128) unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS3582 |
C. elegans |
unc-4(e120) II; arIs92. Show Description
arIs92[egl-17p::NLS-CFP-LacZ + unc-4(+) + ttx-3::GFP]. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS3754 |
C. elegans |
sel-13(ok303) III; arIs51 IV; sel-7(n1253) unc-3(e151) X. Show Description
arIs51[cdh-3::GFP]. sel-13=T04A8.10. Reported strong daf-c; raise at 15 C (personal communication to the CGC). Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS419 |
C. elegans |
evl-3(ar118)/dpy-10(e128) unc-4(e120) II; him-5(e1467) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Throws males. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS6107 |
C. elegans |
arIs107. Show Description
arIs107 [mir-61p::2xNLS::YFP + ttx-3p::GFP + pha-1(+)]. References: Yoo AS, Greenwald I. Science. 2005 Nov 25;310(5752):1330-3. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS7637 |
C. elegans |
cyk-1(or596) III; arIs198. Show Description
Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter.
|
|
| GS7638 |
C. elegans |
exc-6(gk386) cyk-1(or596) III; arIs198. Show Description
Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals.
|
|
| GS7960 |
C. elegans |
exc-6(gk386) cyk-1(or596) III; inft-2(ok1296) V; arIs198. Show Description
Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals. Strain is quite sick even at the permissive temperature.
|
|
| GS807 |
C. elegans |
unc-32(e189) lin-12(n676n930) III; sqt-3(sc8) sel-1(e1948) V. Show Description
RollerUnc. At 25C e1948 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. e1948 recessively suppresses vulval lineage defects and proximal mitosis. sc8 previously called rol-4(sc8). See also WBPaper00002448. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS878 |
C. elegans |
unc-32(e189) lin-12(n676n930) III; lon-3(e2175) sel-10(ar41) V. Show Description
Long. Unc. At 15C ar41 suppresses the 2 AC (anchor cell) phenotype of n676n930. (Strain GS878 does not contain sel(arX) and therefore does not suppress the Egl phenotype at 25C.) See also WBPaper00002966. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS9922 |
C. elegans |
arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I (-3.80). The first intron of GFP was replaced with a Flexon containing two FRT sites. GFP::H2B is expressed at a high level in lineages where Flp recombiase is expressed with a second transgene. Flexon contains two FRT sites. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
|
|
| GW304 |
C. elegans |
unc-119(ed3) III; gwIs28. Show Description
gwIs28 [myo-3::mCherry + 256xlacO + unc-119(+)]. Superficially wild-type. Contains a small lacO array co-integrated with a muscle specific mCherry reporter (~10x smaller than the gwIs4 array). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364
|
|
| GW398 |
C. elegans |
gwIs39 gwIs34 unc-119(ed3) III. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs34 [myo-3::mCherry + 256xlacO + unc-119(+)] III. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364
|
|
| HAL230 |
C. elegans |
unc-119(ed3) III; emcSi71 IV. Show Description
emcSi71 [myo-3p::TIR1::mRuby] (IV: -0.05). TIR1 expression driven by the myo-3 promoter, allowing degradation of AID-tagged proteins specifically in muscles. Reference: Sabatella M, et al. Cell Rep. 2021 Jan 12;34(2):108608. PMID: 33440146
|
|
| HCC21 |
C. elegans |
hwSi3 II; unc-119(ed9) III. Show Description
hwSi3 [pie-1p::GFP::mex-3::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing full-length MEX-3 uniformly throughout oocytes and early embryos through the 4-cell stage. GFP::MEX-3 then mirrors endogenous MEX-3, disappearing from somatic cells by about the 12-cell stage. Also detected in P granules. GFP::MEX-3 can replace endogenous MEX-3. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.
|
|
| HCC27 |
C. elegans |
hwSi8 II; unc-119(ed9) III. Show Description
hwSi8 [pie-1p::GFP::mex-3(601-1248)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing a portion of MEX-3(601-1248) required for protein degradation. At about the 12-cell stage, soma-germline asymmetry is briefly visible before GFP::MEX-3(601-1248) becomes undetectable even in the germline blastomeres. Detected weakly on P granules only in the presence of endogenous MEX. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.
|
|
| HCC31 |
C. elegans |
hwSi13 II; unc-119(ed9) III. Show Description
hwSi13 [pie-1p::GFP::mex-3(2-636)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing truncated MEX-3 that is missing a portion required for protein degradation. GFP::MEX-3(2-636) is extraordinarily stable, persisting in somatic cells through the comma stage (~550 cells) at levels similar to those in 1- and 2-cell embryos. Also detected on P granules through hatching. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.
|
|
| HS1673 |
C. elegans |
lin-17(n3091) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); vpIs1 X. Show Description
vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3091 homozygotes (Sys Unc Psa). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
|
|
| HS178 |
C. elegans |
psa-3(os8) X. Show Description
Superficially WT. Defects in asymmetric T cell division causes Psa (phasmid socket absent) phenotype.
|
|
| HS2326 |
C. elegans |
cwn-1(ok546) II; egl-20(n585) cwn-2(ok895) IV/nT1 [qIs51] (IV;V); vpIs1 X. Show Description
vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok546 homozygotes (Unc Egl). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
|
|
| HW1870 |
C. elegans |
lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) I. Show Description
Pick GFP+ Egl to maintain. Segregates GFP- lin-41(xe8) homozygotes (die by vulval bursting as young adults), lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) heterozygotes (GFP+ Egl), and lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) (GFP+ Ste Dpy). lin-41(xe8) is a deletion of let-7 binding sites in the lin-41 3'UTR. The balancer was derived from lin-41(bch28), a lin-41(0) allele in which an expression cassette that drives ubiquitous nuclear GFP from the eft-3 promoter has been inserted into the lin-41 coding sequence (Katic et al., G3 (2015) 5:1649-56). References: Katic et al., G3 (2015) 5:1649-56 for lin-41(bch28) starting allele for balancer generation. Aeschimann F, et al. (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. for balanced line. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| HX103 |
C. elegans |
chd-3(eh4) X. Show Description
T14G8.1 Deletion of 2018 bp of T14G8.1 [nucleotide 3699 (in exon 4) joined to 1682 (in exon 6)]. No phenotype observed.
|
|
| HY483 |
C. elegans |
bre-3(ye26) III. Show Description
Resistant to Cry5B Bt toxin.
|
|
| HY601 |
C. elegans |
mat-3(or344) III. Show Description
Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-4(or344).
|
|
| HY607 |
C. elegans |
apc-1(or319) II. Show Description
Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 24C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2.
|
|
| HY618 |
C. elegans |
apc-1(or374) II; him-5(e1490) V. Show Description
Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2..
|
|
| HY619 |
C. elegans |
apc-1(or385) II; him-5(e1490) V. Show Description
Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2.
|
|