Search Strains

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs. h442 arrests as an early larva. Maintain by picking Unc-13 and checking for correct segregation of progeny.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h505 arrests as a mid-stage larva). This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

ynIs40 [flp-11p::GFP] V. kas1 is a point mutation in the second intron splice acceptor site, disrupting splicing. Worms are vulvaless and have severe locomotion defects. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx80 [oig-1p::tagRFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to maintain array. RFP driven by minimal oig-1 promoter for expression in VD-type GABAergic motor neurons. This construct uses the minimal length of promoter containing overlapping LIN-39 and UNC-30 ChIp-seq peaks (deletion of the single LIN-39 binding site within it compromised GABAergic motor neuron expression). Whereas other available oig-1 constructs are expressed ectopically in cholinergic motor neurons in unc-3 mutants, expression of this construct remains exclusively in GABAergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx73 [unc-3p::dsUnc-3(RNAi) + myo-2p::GFP]. Pick GFP+ to maintain array. Array carries a construct with the unc-3 promoter driving transcription of a hairpin targeting unc-3 for RNAi depletion in cholinergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

mNeonGreen and AID* tags inserted into endogenous cfi-1 locus. Transgene can be degraded in a background expressing TIR1 co-factor supplemented with auxin. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.

kasEx147 [oig-1p(1.6kb)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 1.6kb cis-regulatory region (-2.6-1.0kb) upstream of oig-1 was fused to GFP with the unc-54 3'UTR. oig-1 uses mulitple cis-regulatory regions to achieve different expression patterns in motor neurons; this construct drives expression specifically in cholinergic motor neurons. Construct was injected into N2 worms. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx149 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 200bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is been abolished; expression was observed specifically in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx151 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 300bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is retained, but eliminates ectopic expression in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx271 [pxd-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with pxd-1 genomic region (-2,165 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx273 [cal-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with cal-2 genomic region (-3,326 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx275 [lgc-4::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with lgc-4 genomic region (-669 to +1,797 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx277 [ldb-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with ldb-1 genomic region (+1,063 to +4,393 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx279 [nep-21::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with nep-21 genomic region (-3,471 to -865 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx281 [D2007.2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with D2007.2 genomic region (-2,997 to -517 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx283 [dmsr-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with dmsr-2 genomic region (-3,452 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx284 [ncs-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with ncs-2 genomic region (-3,455 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx286 [npr-29::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with npr-29 genomic region (-9,810 to -6,028 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx288 [drn-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with drn-1 genomic region (-6,346 to -4,825 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain for somatic depletion of NHR-23::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY87 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.

Homozygous viable. km11 is a deletion/duplication of klc-2; see Sakamoto, et al. PMID: 15563606 for detailed description. Reference: Sakamoto R, et al. Mol Biol Cell. 2005 Feb;16(2):483-96. PMID: 15563606

rnyEx60 [vha-6p:::vha-6::mCherry + myo-3p::GFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. Labels apical intestinal membrane. Reference: Allman et al. (2009) Am J Physiol Cell 297:C1071-81.

rnyEx109 [nhx-2p::D3cpv + pha-1(+)]. Maintain at 20-25C to select for array. KWN190 strain expresses the FRET-based calcium indicator protein D3cpv throughout the cytoplasm of intestinal cells. Dual emission ratio imaging (ex. 435, em. 480/535-nm) can be used to measure intestinal calcium and, although the FRET pair is CFP/YFP, intestinal D3cpv fluorescence is observable under standard GFP filter sets. The D3cpv biosensor has the advantages of being relatively pH-insensitive and not interfering with endogenous calmodulin signaling. References: Am J Physiol Cell Physiol. 301:C1389-1403. Am J Physiol Cell Physiol. 297:C1071-81. FASEB J. 27:760-768. PLoS Biol. 11: e1001613.

rnyEx133 [opt-2p:::opt-2(aa1-412)::GFP) + pha-1(+)]. Maintain at 25C to select for animal carrying the array. Labels apical intestinal membrane. Reference: Nehrke (2003) 278(45):44657-66.

rnyEx6 [nhx-2p::pHluorin + pha-1(+)]. Maintain at 20-25C to select for array. KWN26 strain expresses the pH-sensitive GFP variant pHluorin throughout the cytoplasm of intestinal cells. Dual excitation ratio imaging (ex. 410/470, em. 435-nm) can be used to measure intestinal pH and intestinal pHluorin fluorescence is observable under standard GFP filter sets. References: J Biol Chem 278:44657-44666. Curr Biol. 18: 297-302. Am J Physiol Cell Physiol. 297:C1071-81. Am J Physiol Cell Physiol.302 C1045-1054.

At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.

No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).

In-frame CRISPR/Cas9 fusions into the genes encoding the eIF4E paralogs IFE-1 and IFE-3. Red and Green fluorescence, respectively. Strong fluorescence for both in the hermaphrodite and male gonads, but with distinct expression character and germ granule association. Germ cell cytoplasmic expression and lesser somatic expression are also observed. Both insertions are homozygous by PCR confirmation.

C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).

Defecation motor program defects (Aex), pale and starved-looking, tends to stay still but not Unc.

Superficially WT. by108 completely suppresses the Egl defect of sel-12 mutants. by108 derepresses the transcription of hop-1 in the early larval stages. This strain may not be used for commercial purposes.

Superficially WT. byDf1 completely suppresses the Egl defect of sel-12 mutants. byDf1 derepresses the transcription of hop-1 in the early larval stages. byDf1 is a deletion of 31,069 bases from position 3052 of cosmid F46H6 to position 6698 of cosmid C07A12 with a single A base pair insertion. byDf1 deletes F46H6.2/dgk-2, F46H6.4, F46H6.1/rhi-1, C07A12.5/spr-3 and part of C07A12.7. byDf1 is null for spr-3 by sequence and northern analysis. Deletion can be detected with the primers RB1222 CTT ACT AGT ACT AGC TCG CG and RB1224 CCT GTC CAT AAG TGC AGT CC, which give a product of 1540 bp. This strain may not be used for commercial purposes.

Pvl. Egl. Poor mating.

Superficially WT. by1-5 strongly suppresses the Egl defect of sel-12 mutants. About 5% of spr-4(by105) I; sel-12(ar171) X double mutants are Egl. This strain may not be used for commercial purposes.

Animals with the duplication are WT. Animals which have lost the duplication arrest at 3rd larval stage with increased life span. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.

Heterozygotes are WT and segregate WT, Dpy(ts) Steriles and Uncs which arrest in the L3 larval stage. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.

uaDf5/+ is stable as a heterozygote. The strain does not appear to segregate live animals with uaDf5/uaDf5 or +/+ genotypes. Throws males.

juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.

juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.

geEx1 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Pick Rolling GFP+ and check for correct segregation of progeny to maintain. skn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Reference: Nature (2007) 447(7144):545-9.

geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.

geIs10 [ges-1p(long)::skn-1c::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.

ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr6 is G-to-A causing a G158E substitution. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G158E substitution site of the ldr6 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276

ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr5 is C-to-T substitution causing a premature stop (Q139*). Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The Q139* premature stop in the ldr5 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276

ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr4 is a G-to-A mutation in the splice donor site of Intron 1. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G-to-A mutation in the splice donor site is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276

Caenorhabditis elegans wild isolate. Isolated from Dypsis baronii (palm seed) on June 17, 2005 in Madagascar. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. avIs116 [pie-1p::GFP::ubiquitinAA + unc-119(+)]. GFP::ubiquitinAA is visible in the germline when raised at 25C. GFP::ubiquitinAA is a mutated form of ubiquitin that has a dialanine at the C-terminus instead of the diglycine required for conjugation onto protein substrates. Useful control strain for LN130. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Sampuda KL, et al. BMC Cell Biol. 2017 Apr 19;18(1):18.

Roller. Reduced brood size and reduced sperm count. CRISPR/Cas9 GFP insertion at amino acid 216 of RPN-6.2a. Expression of GFP in the spermatogenic germline. The SEC (self excising cassette) contains the stop codon and transcriptional termination signal for GFP as well as a sqt-1(d) allele. Pick rollers to maintain the strain with the SEC. Excision will result in an in frame fusion of GFP at amino acid 216 of RPN-6.2a or amino acid 5 of RPN-6.2b.

Entire che-12 coding sequence deleted and replaced with GFP. This produced a phenotype that is more penetrant than that reported for the original che-12 strain, which introduced a nonsense mutation midway through the coding region. Short amphid and phasmid cilia. Defective chemotaxis to NaCl. Dye-filing defective. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.