More Fields
Strain Species Genotype
KX17 C. elegans ife-4(ok320) X. Show Description
C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).
RB2354 C. elegans F15D4.4(ok3200) II. Show Description
F15D4.4 Homozygous. Outer Left Sequence: ggtagatttaaagcgcgtcg. Outer Right Sequence: ttccggaaatatgcaggaag. Inner Left Sequence: agcgcgaaaaattcaatgag. Inner Right Sequence: gttcaattccggcagtttg. Inner Primer PCR Length: 1171. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2355 C. elegans lev-1(ok3201) IV. Show Description
F09E8.7 Homozygous. Outer Left Sequence: atcgattgctcgttgagctt. Outer Right Sequence: gctcgactttctcacttcgg. Inner Left Sequence: gctcatcatccagctcatca. Inner Right Sequence: ccgtgtcgatttttcggaat. Inner Primer PCR Length: 1300. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2356 C. elegans C24B9.9(ok3202) V. Show Description
C24B9.9 Homozygous. Outer Left Sequence: ttatttctgggctcgcattc. Outer Right Sequence: agtagttgcggctgagttcc. Inner Left Sequence: ggtcgaagtgatacctgtgga. Inner Right Sequence: tgacattttgaagcaaatcaatg. Inner Primer PCR Length: 1238. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2357 C. elegans F41H10.6(ok3203) IV. Show Description
F41H10.6 Homozygous. Outer Left Sequence: ggggtgatttcgggtctaat. Outer Right Sequence: tccaacactcatcggattca. Inner Left Sequence: agtgaagtccgagacggaaa. Inner Right Sequence: agtatgcccaacacatccg. Inner Primer PCR Length: 1139. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2358 C. elegans Y54G2A.25(ok3204) IV. Show Description
Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2359 C. elegans Y54G2A.25(ok3205) IV. Show Description
Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2360 C. elegans ZC477.2(ok3206) IV. Show Description
ZC477.2 Homozygous. Outer Left Sequence: agtgaatgaaggagcggaaa. Outer Right Sequence: cttgtaggcatgaaggggaa. Inner Left Sequence: tcctcgatcgattgaatgc. Inner Right Sequence: acgccggaacttctgactct. Inner Primer PCR Length: 1236. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2361 C. elegans nas-24(ok3207) V. Show Description
F20G2.4 Homozygous. Outer Left Sequence: ggagtggttcagctggagag. Outer Right Sequence: aaaacgattgcagaaaacgg. Inner Left Sequence: atggagactggatggtgtgc. Inner Right Sequence: caatgatggttgggttgtga. Inner Primer PCR Length: 1114. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2362 C. elegans abf-5(ok3208) X. Show Description
T22H6.5 Homozygous. Outer Left Sequence: gagatgagtcaggaccgagc. Outer Right Sequence: atcccattgcctcaccaata. Inner Left Sequence: ctgccactattgtcacaaaatct. Inner Right Sequence: gccaactctttctcagcacc. Inner Primer PCR Length: 1198. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2363 C. elegans Y51H4A.13(ok3209) IV. Show Description
Y51H4A.13 Homozygous. Outer Left Sequence: aagccagtagatgtcgggtg. Outer Right Sequence: gccagaaccctgtgaatgat. Inner Left Sequence: tacagcgtccgacatctcac. Inner Right Sequence: tcgaattttcgacaaatcaataa. Inner Primer PCR Length: 1264. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807