Strain Information

Name KX10   View On Wormbase
Species C. elegans
Genotypeife-3(ok191)/unc-34(e566) V.
DescriptionAt 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.
MutagenUV/TMP
Outcrossedx10
Made byBD Keiper
Laboratory KX
Sign in or register an account if you want to order this strain.