At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.

H38K22.5. Homozygous. Outer Left Sequence: CAGTGGTCCAAATTGCTTCC. Outer Right Sequence: TTCAAAAAGGCGCTGAAAAT. Inner Left Sequence: ATCGAAAATGTCCGGTGAAG. Inner Right Sequence: TCGTCGATCCAGAAGATGTG. Inner Primer PCR Length: 2814 bp. Deletion Size: 1281 bp. Deletion left flank: ATTCCAATTGAATCCACCTCGAAACATTTC. Deletion right flank: AACTCTTCTCTTACCATATCACTCAAAAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G2.1. Homozygous. Outer Left Sequence: AACCTCGTAAATATCGCGCA. Outer Right Sequence: AGCGTGCTGGATACACCTCT. Inner Left Sequence: GCAGCGACCGTAGCTAATTT. Inner Right Sequence: ATGGCACTGGGATGAGTAGG. Inner Primer PCR Length: 2170 bp. Deletion Size: 766 bp. Deletion left flank: GAGACGACAACTGTTGCAGAGGATGTTCCA. Deletion right flank: CTGCAATCGAGCCATGCTCTCAACACTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G2.1. Homozygous. Outer Left Sequence: AACCTCGTAAATATCGCGCA. Outer Right Sequence: AGCGTGCTGGATACACCTCT. Inner Left Sequence: GCAGCGACCGTAGCTAATTT. Inner Right Sequence: ATGGCACTGGGATGAGTAGG. Inner Primer PCR Length: 2170 bp. Deletion Size: 722 bp. Deletion left flank: TGTGACTACGTTATGAATGTTCCAGAGTGC. Deletion right flank: CAACCACAACTATCGGTTACGCTCCAATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18H9.8. Homozygous. Outer Left Sequence: CTGCTGGTGTAGGACATGGA. Outer Right Sequence: ATCAATCAAAAAGATCGCCG. Inner Left Sequence: AAACACGCATCAACCACAAA. Inner Right Sequence: GGGTAAAACGACGGAAACAA. Inner Primer PCR Length: 3267 bp. Deletion Size: 1372 bp. Deletion left flank: ATTTGAATGGCGATATGTCGGATATTGAGT. Deletion right flank: CAATTGAGGATATGGAATTGGCGTTAAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R08E3.4. Homozygous. Outer Left Sequence: CTTGGGATGTTTTCTCCGAA. Outer Right Sequence: CGCTTCTATTGCGTTTCACA. Inner Left Sequence: AGTTATCGGAGGTGTCGGTG. Inner Right Sequence: AAACGAGCACAGCAGGTCTT. Inner Primer PCR Length: 3130 bp. Deletion Size: 1005 bp. Deletion left flank: AATTTACAATTTTCTCTGGTTTTCTCCTCG. Deletion right flank: TTTTAAAAATTGCTCACCTTCTGGCTGAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28A8.7. Homozygous. Outer Left Sequence: TTGGCACTGCTTGTAAAACG. Outer Right Sequence: CCGTAACCCAATACCCAACA. Inner Left Sequence: TATGTTCCACATCGCTCGAA. Inner Right Sequence: CAGTTGCTAGATGGGTGCAA. Inner Primer PCR Length: 3200 bp. Deletion Size: 1100 bp. Deletion left flank: ACGCCGATATTTTCTTATCGAGTGTGATGA. Deletion right flank: TTTTAAATTTTGGGATTCTAGGCCACCAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55G11.5. Homozygous. Outer Left Sequence: GGTCGAGCTCACACTTCTCC. Outer Right Sequence: AGCTGGTAAAAGCACTCCCA. Inner Left Sequence: GCTTTCCTGCGTCTTTTGAG. Inner Right Sequence: AAGGCAAGGCTGTATTCACG. Inner Primer PCR Length: 2425 bp. Deletion Size: 1426 bp. Deletion left flank: ATGGATCGGGATACATATTTTCAGACAATT. Deletion right flank: TGTGGTCAGTAGTGGAAAAGCTGATTTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M142.2. Homozygous. Outer Left Sequence: TAATTGGCAGCCCAAATGAT. Outer Right Sequence: CAAAAAGTATTTTCCCGCCA. Inner Left Sequence: AATCCTTATCTGCTCCGCAA. Inner Right Sequence: TGGGATAACCTGGCTCTACG. Inner Primer PCR Length: 3255 bp. Deletion Size: 1492 bp. Deletion left flank: TACGCATCCTATGAATGTTCCTACATTTAT. Deletion right flank: AAAACGGAAACACTAAAAACTTTGAAACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK20.3, ZK20.4. Homozygous lethal/sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1910 homozygotes (late larval arrest or sterile adult with no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGACTTGCATCGTCTCCAA. External right primer: AGAGCCTTCTCAACTGCGAC. Internal left primer: TGACAGGATTCTGGCCTTTT. Internal right primer: AGAAGATTTTTATGGGCGGC. Internal WT amplicon: 2172 bp. Deletion size: 1030 bp. Deletion left flank: AAATTTCTCACTTCGTAGCATCCAAATCTG. Deletion right flank: AATCTGGTTCTTGGTCAGCAGCATCATCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1911 homozygotes (mid- to late-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATGTTTCAACAAGCAGCGA. External right primer: AGTGGCACGGATAAGGATTG. Internal left primer: CACAACCGCAACAAATGAAC. Internal right primer: GATGAGTGATTCCAGGCGTT. Internal WT amplicon: 3035 bp. Deletion size: 918 bp. Deletion left flank: ATGAAGTACGTACACAATTCTCAAAGTATT. Deletion right flank: AATTAATTGCAACAATGTATCAAACTGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807