Search Strains

More Fields
Strain Species Genotype Add
LP728 C elegans mig-5(cp385[mNG-GLO::AID*::mig-5]) II. Show Description
FP knock-in. mNG-GLO is a germline-optimized variant coded to be less prone to silencing in the germline. [NOTE: (4/1/2021) A lab has reported finding a second GFP insertion in LP728; it has not yet been confirmed whether or not it is present in the current CGC stock.] Reference: Heppert JK, et al. 2017 Genetics. In press.
LP815 C. elegans cpIs158 I; cpIs130 II; egl-20(cp400[egl-20::YPET::3xFlag]) IV. Show Description
cpIs158 [myo-3p::pat-3sp::2x vhhGFP4::CD8 tm::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs130 [wrt-2p::2x mKate2::PH::3xHA::let-858 3'UTR::tag-168p::HisCl1::tbb-2 3'UTR loxN] II. YPET::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. cpIs158 expresses a membrane-anchored anti-GFP nanobody (Morphotrap) in body wall muscles. This version of Morphotrap consists of extracellular 2x vhhGFP4 fused to a human CD8 transmembrane domain and intracellular 2x mTurquoise2. Endogenously tagged EGL-20::YPET::3xFlag is efficiently sequestered by the Morphotrap transgene (the transgene functions as expected for Wnt), leading to Q neuroblast migration defects. NOTE: cpIs158/Morphotrap does not capture all YPET-tagged extracellular proteins, so sequestration should be determined empirically. cpIs130 is a single copy transgene expressing a 2x mKate2::PH membrane marker in seam cells, Q neuroblasts, and many hypodermal cells, and HisCl1 expression from the tag-168 upstream intergenic sequence. Expression of HisCl1 from the single copy insertion does not appear to be sufficient for immobilizing animals. cpIs158 was inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs130 was inserted at Chr II:8420157-8420243 near ttTi5605. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
LP858 C. elegans lea-1(cp431[mNG::3x FLAG::AID*::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
LP860 C. elegans daf-2(e1370) III; lea-1(cp431[mNG::3x FLAG::AID*::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
LP869 C. elegans cpSi171 I. Show Description
cpSi171 [vha-8p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in multiple tissues including intestine, hypodermis, and excretory cell.
LP870 C. elegans cpSi172 I. Show Description
cpSi172 [myo-2p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in the pharynx.
LP871 C. elegans cpSi174 I. Show Description
cpSi174 [myo-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in body wall muscle.
LSD1091 C. elegans smg-1(cc546) I; xchEx91. Show Description
xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LSD1097 C. elegans smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LSJ1 C. elegans C. elegans wild isolate. Show Description
Caenorhabditis elegans wild isolate. This strain has been grown axenically in liquid culture for several years. It was grown on E. coli OP50 so that it could be raised on agar plates and frozen. It will need to have the E. coli removed. This culture originated at UC Berkeley and was once called C. briggsae UC Berkeley strain. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
LV13 C. elegans unc-45(wc4)/unc-45(e286) III. Show Description
Maintain this strain at 15C so that you can score for dead eggs (3 fold stage). At 15C, both hets and e286 homozygotes move reasonably well. Place single animals on plates and allow them to lay eggs for a day; then remove the parent and score the plates the next day for dead eggs. At 25C, both hets and e286 homozygotes will be Unc and Egl; dead eggs will remain inside the parent worm.
LV18 C. elegans unc-45(wc1) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (dauer escapers will be Par and give only dead eggs), and DpyUcs which arrest as dead eggs (range from twitching multicellulars to 3-folds that hatch). [There is a greater percentage of hatchlings when the mother is heterozygous (wc1 dpy-1/+). There may also be the possibility of near complete maternal rescue (near full-sized, sterile Dpys), but this has not been routinely observed in the balanced strain (as opposed to wc1 dpy-1/+).] Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: The dauers are not giving dead eggs-they are giving other dauers. Appears that the Par mutation is no longer present.]
LV19 C. elegans unc-45(wc2) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (escapers will be Par and give only dead eggs) and DpyUncs which are dead eggs (a range of embryonic lethality from multicellular twitchers to 3-folds that do not hatch). Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: the dauers are giving dead eggs.]
LW2286 C. elegans lon-2(e678) X; jjIs2277. Show Description
jjIs2277 [pCXT51(5*RLR::pes-10p(deleted)::GFP) + LiuFD61(mec-7p::RFP)]; integrated on LG I or IV. Reference: Tian et al. (2010) Development 137(14):2375-84.
LW2308 C. elegans dbl-1(wk70) V; jjIs2277. Show Description
jjIs2277 [pCXT51(5*RLR::pes-10p(deleted)::GFP) + LiuFD61(mec-7p::RFP)]; integrated on LG I or IV. Reference: Tian et al. (2010) Development 137(14):2375-84.
LW2436 C. elegans jjIs2277. Show Description
jjIs2277 [pCXT51(5*RLR::pes-10p(deleted)::GFP) + LiuFD61(mec-7p::RFP)]; integrated on LG I or IV. Reference: Tian et al. (2010) Development 137(14):2375-84.
LW905 C. elegans lmn-1(tm1502) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1502 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
LWA1031 C. elegans wleSi1852 I; wleSi1565 X. Show Description
wleSi1852 [unc-54p::luciferaseTAG185 + Cbr-unc-119(+)] I. wlels1565 [unc-54p::DanRS_rpr-1::tRNA(CUA)Leu + myo-2p::GFP] X. It is likely that unc-119(ed3) remains in the background. Animals are slightly sick. All animals should express GFP in their pharynx. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
LWA1560 C. elegans wleSi151 II. Show Description
wleSi151 [unc54p::mCherryTAG156 + Cbr-unc-119(+)] II. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the mCherry reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
LWA1564 C. elegans wleSi151 II; wleEx35. Show Description
wleSi151 [unc54p::mCherryTAG156 + Cbr-unc-119(+)] II. wleEx35 [unc-54p::DanRS_rpr-1::tRNA(CUA)Tyr + myo-2p::GFP]. Pick animals expressing GFP in their pharynx to maintain wleEx35. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the mCherry reporter is dependent upon expression of temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
LWA1582 C. elegans wleSi1582 I. Show Description
wleSi1582 [unc-54p::JFF_luciferaseTAG185 + Cbr-unc-119(+)] I. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Expression of the Japanese firefly luciferase reporter can be detected using standard luciferase assays. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
LWA1852 C. elegans wleSi1852 I; wleSi1853 X. Show Description
wleSi1852 [unc-54p::luciferaseTAG185 + Cbr-unc-119(+)] I. wlels1853 [unc-54p::OmeRS_rpr-1::tRNA(CUA)Tyr + myo-2p::GFP] X. It is likely that unc-119(ed3) remains in the background. Animals are slightly sick. All animals should express GFP in their pharynx. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
LX147 C. elegans rgs-1(nr2017) III. Show Description
Very weak Egl. rgs-1=C05B7.7, a C. elegans RGS (Regulator of G protein Signaling) gene. nr2017 is a presumptive null allele. nr2017 is a 638 bp deletion of sequences whose limits are CGAGAAATTGTCAACACTAAC...GTTTGGAATGGTTTATCAGTT. The deleted material is replaced by the following 35 bp insertion: TATGTTTAAGTTAAGTTTATAGTTTAAGTTTAAAG.
LX160 C. elegans rgs-2(vs17) X. Show Description
rgs-2=F16H9.1, a C. elegans RGS (Regulator of G protein Signaling) gene. vs17 is a presumptive null allele. vs17 is a 1136 bp deletion of sequences with limits: ATATATATATCTCATTACTGG...AATCAAGTGTAACACTAATAT. rgs-1;rgs-2 double mutants fail to rapidly turn on egg-laying behavior when fed after starvation.
LX1836 C. elegans wzIs30 IV; lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
wzIs30 [egl-6::ChR2-YFP + lin-15(+)] IV. Strain carries integrated transgene wzIs30 that expresses YFP-tagged channelrhodopsin under the egl-6 promoter in HSN and some head and tail neurons. Strain is in lite-1(ce314) and lin-15(n765ts) background. The transgene contains a rescue for lin-15 as a marker. Reference: Emtage L, et al. J Neurosci. 2012 Nov 14;32(46):16285-95.
LX1918 C. elegans vsIs164 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs164 [unc-103p(E)::GCaMP5 + unc-103p(E)::mCherry + lin-15(+)] X. Integrated transgene using unc-103e promoter to drive GCaMP5 and mCherry expression in vulval muscles; useful for visualizing and quantitating calcium influx in vulval muscle cells. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX1960 C. elegans lite-1(ce314) lin-15B&lin-15A(n765) X; vsIs172. Show Description
vsIs172 [lin-11(enhancer)::pes-10p::GCaMP5 + lin-11(enhancer)::pes-10p::mCherry + lin-15(+)]. Integrated transgene using lin-11 enhancer region fused to the pes-10 basal promoter to drive GCaMP5 and mCherry expression in VC motor neurons; useful for visualizing and quantitating calcium influx in VC motor neurons. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX1986 C. elegans vsIs177 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs177 [ocr-2p::GCaMP5::ocr-2 3'UTR + ocr-2p::mCherry::ocr-2 3'UTR + lin-15(+)] X. Integrated transgene using ocr-2 promoter to drive GCaMP5 and mCherry expression in uv1; useful for visualizing and quantitating calcium influx in uv1 cells. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX2004 C. elegans vsIs183 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs183 [nlp-3p::GCaMP5::nlp-3 3'UTR + nlp-3p::mCherry::nlp-3 3'UTR + lin-15(+)] X. Integrated transgene using nlp-3 promoter to drive GCaMP5 and mCherry expression in HSN; useful for visualizing and quantitating calcium influx in HSN. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX658 C. elegans mnDp33 (X;IV)/+ IV; unc-20(e112) rgs-7(vs92) X. Show Description
Heterozygotes are WT. Animals which have lost the duplication are Unc and homozygous for rgs-7. Animals which are homozygous for the duplication are dead. Unc is temperature sensitive. vs92 is a 361 bp deletion which removes the 3' splice site of exon 6, all of exon 7 and half of exon 8. All of the deleted region is within the RGS domain.
LX671 C. elegans ocr-2(vs29) IV. Show Description
Lays 86% of its eggs at the 8-cell or earlier stage.
LX677 C. elegans rgs-7(vs98)/unc-1(n496) lon-2(e678) X. Show Description
Heterozygotes are Unc but not Lon. n496 is dominant. Segregates LonUnc. vs98 homozygotes are non-Unc, non-Lon and are Mel (they give only dead eggs). Strain will break down due to recombination so check for the presence of vs98 by PCR every few generations. Received new stock Feb 2005.
LX733 C. elegans rgs-10&rgs-11(vs110) X. Show Description
This deletion removes sequence 5' to start of rgs-10 and may therefore remove promoter sequence for rgs-10&rgs-11.
LX837 C. elegans vsIs45. Show Description
vsIs45 [tph-1::GFP]. tph-1::GFP in vsIs45 is expressed exclusively in the NSM neurons in larvae and NSM + HSN in adults, whereas other tph-1::GFP reporters are also expressed in other serotonergic neurons; can be used to image NSM development and for FACS isolation of NSM from L1s. Reference: Nelson JC, Colon-Ramos DA. J Neurosci. 2013 Jan 23;33(4):1366-76.
LX959 C. elegans vsIs13 IV; lin-15B&lin-15A(n765) X. Show Description
vsIs13 [lin-11::pes-10::GFP + lin-15(+)]. Expresses GFP in all 6 VC neurons, as well as in the posterior intestine. This is also uncharacterized embryonic expression.
LX975 C. elegans vsIs13 IV; lin-15B&lin-15A(n765) X; vsIs97; vsIs100. Show Description
vsIs13 [lin-11::pes-10::GFP + lin-15(+)]. GFP expression in six VC neurons and posterior intestine. vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab]. vsIs100 [myo-3p::CFP + lin-15(+)]. CFP expression in VMs. Additional background expression seen as punctate nucleolar fluorescence along the ventral side of the worm (also present in wild-type).
MAD36 C. elegans unc-119(ed3) III; dqIs44. Show Description
dqIs44 [pie-1::mCherry::moe + unc-119(+)]. Can be maintained at room temperature; shift to 25C for RNAi and imaging. Strain does not do well when kept at 25C for multiple generations. Reference: Shivas JM & Skop AR. Mol Biol Cell. 2012 May;23(10):1917-27.
MAH235 C. elegans sqIs19. Show Description
sqIs19 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Rollers. Slightly longer lived at 20C. hlh-30::GFP expression should be visible at relatively low magnification. [NOTE: the array does not segregate 100% in original stock; pick GFP+ and check for correct segregation to maintain the array. New stock recevied at CGC June, 2016.] Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.
MAH44 C. elegans glp-1(e2141) III; adIs2122. Show Description
adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Sterile at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.
MAH50 C. elegans daf-16(mu86) I; glp-1(e2141) III; adIs2122. Show Description
adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Sterile at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.
MAH547 C. elegans sqEx82. Show Description
sqEx82 [argk-1p::GFP + rol-6(su1006)]. Pick Rollers with GFP expression in nerve ring and posterior intestine to maintain. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.
MAH68 C. elegans mes-1(bn7) X; adIs2122. Show Description
adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Approx. 50% sterility at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.
MC907 C. elegans aatf-1(gc63 gc64) I. Show Description
Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). gc63 gc64 occurred in the same mutagenesis; unclear which allele (or if both) is causing the gain of function. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MCJ11 C. elegans mir-35(cdb2 cdb4) II. Show Description
Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ180 C elegans mir-35(cdb2 cdb72) II. Show Description
cdb2 cdb72 is a mutation to the 3' end of the mature mir-35 creating a 3’ end containing nucleotides that are not present or rare among all mir-35 family members at a given position, while preserving overall GC content. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.
MCJ217 C. elegans mir-35(cdb2 cdb4) II; egl-1(cdb97) V. Show Description
Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MG617 C. elegans xsSi5 II. Show Description
xsSi5 [pie-1p::GFP::ani-1(AH+PH)::pie-1 3'UTR + Cbr-unc-119(+)] II. The RhoA biosensor consists of GFP fused to the C-terminal portion of C. elegans anillin, which contain its conserved region (AH) and pleckstrin homology (PH) domain. It lacks the N-terminal myosin- and actin-binding domains but retains its RhoA-binding domain. [NOTE: xsSi5 was originally published as mgSi5.] References: Tse YC, et al. Mol Biol Cell. 2012 Oct;23(20):4020-31.
MG827 C. elegans unc-119(ed3) III; xsSi36 IV. Show Description
xsSi36 [myo-2p::GFP(Y66C)::let-858 3'UTR + Cbr-unc-119(+) IV:13,048,924]. This strain contains a non-fluorescent GFP that can be used to enrich for CRISPR mediated, oligodirected homologous recombination. [NOTE: previously published as mgSi36.]  Reference: Zhang D & Glotzer M. 2014. Efficient site-specific editing of the C. elegans genome. doi: http://dx.doi.org/10.1101/007344.
MH1157 C. elegans him-5(e1490) V; egl-13(ku194) X. Show Description
ku194 is a loss of function allele, likely to be molecular null. Connection of gonad defective, >95% Egl. Anchor cell and uterine seam cell do not fuse. Males can mate. Hermaphrodites are very difficult to mate. Previously called cog-2(ku194).
MH1292 C. elegans sur-6(ku123) I. Show Description
Weak Vul phenotype. Suppressor of gain-of-function Ras. ku123 causes a C302Y substitution.