Strain Information
| Name | KX17 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | ife-4(ok320) X. |
| Description | C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4). |
| Mutagen | UV/TMP |
| Outcrossed | x10 |
| Made by | BD Keiper |
| Laboratory | KX |
Sign in
or
register an account if you want to order this strain.